Incidental Mutation 'R2848:Poteg'
ID251850
Institutional Source Beutler Lab
Gene Symbol Poteg
Ensembl Gene ENSMUSG00000063932
Gene NamePOTE ankyrin domain family, member G
Synonyms
MMRRC Submission 040441-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R2848 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location27447670-27495172 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27481676 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 406 (N406I)
Ref Sequence ENSEMBL: ENSMUSP00000147760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081321] [ENSMUST00000209669] [ENSMUST00000210427]
Predicted Effect probably benign
Transcript: ENSMUST00000081321
AA Change: N410I

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000080069
Gene: ENSMUSG00000063932
AA Change: N410I

DomainStartEndE-ValueType
ANK 80 109 1.46e-2 SMART
ANK 113 142 7.89e1 SMART
ANK 146 175 3.1e-6 SMART
ANK 179 208 2.81e-4 SMART
ANK 212 241 8.62e1 SMART
ANK 245 273 1.23e3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209669
AA Change: N348I

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000210427
AA Change: N406I

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451I11Rik A T 7: 126,830,722 F101Y possibly damaging Het
A230050P20Rik A T 9: 20,873,572 H225L probably damaging Het
Abca17 G C 17: 24,289,507 T1018R probably damaging Het
Adamts14 T A 10: 61,218,435 Q606L probably damaging Het
Adgrf5 C A 17: 43,422,640 N118K possibly damaging Het
Baz2b A T 2: 59,924,666 Y1073N possibly damaging Het
Celf2 T C 2: 6,604,125 R282G probably damaging Het
Cntnap5c A T 17: 57,876,392 D31V probably damaging Het
Cobl A G 11: 12,378,342 L81P probably damaging Het
Cpsf1 A T 15: 76,602,851 L209Q probably damaging Het
Crocc G A 4: 141,018,756 A1684V probably damaging Het
Cyp4f37 T A 17: 32,629,125 C206S probably damaging Het
Diexf A T 1: 193,128,451 N81K probably benign Het
Dnah3 A G 7: 119,967,938 V2355A probably benign Het
Dnah6 T C 6: 73,129,331 K1756E probably benign Het
Fis1 T C 5: 136,963,117 I55T possibly damaging Het
Gm2381 G A 7: 42,820,407 P98S probably damaging Het
Gpr37 C T 6: 25,666,946 probably benign Het
Grin2a A G 16: 9,761,965 F145L possibly damaging Het
Htr4 T C 18: 62,428,126 S153P probably damaging Het
Igkv9-120 T A 6: 68,050,144 probably benign Het
Il12rb1 G A 8: 70,815,802 W396* probably null Het
Itga8 A T 2: 12,160,404 V798D probably damaging Het
Lfng T A 5: 140,611,867 D149E probably damaging Het
Magi2 A AG 5: 20,602,461 probably null Het
Mgam C A 6: 40,652,715 A86E possibly damaging Het
Myh4 A G 11: 67,248,633 N592S probably benign Het
Naa16 A G 14: 79,335,883 C816R probably damaging Het
Nek8 A G 11: 78,168,141 S513P probably damaging Het
Ociad1 A G 5: 73,294,351 probably null Het
Olfr1288 T C 2: 111,479,354 M190T probably benign Het
Olfr350 A G 2: 36,850,799 Y251C probably damaging Het
Olfr721-ps1 C T 14: 14,407,398 P57S probably damaging Het
Osbpl8 T A 10: 111,269,436 S251T probably benign Het
Pcdh7 G A 5: 57,720,276 G391E probably damaging Het
Pcdhga10 T A 18: 37,748,200 V338E possibly damaging Het
Pde4b C T 4: 102,601,545 A466V probably damaging Het
Peg10 C T 6: 4,756,912 probably benign Het
Ppargc1a A G 5: 51,473,809 F493L probably benign Het
Ptpra C A 2: 130,544,999 H603Q probably benign Het
Rnf10 T C 5: 115,249,112 D439G probably benign Het
Syt3 G A 7: 44,393,442 V383I probably benign Het
Tectb C G 19: 55,180,999 probably benign Het
Try5 C T 6: 41,313,476 V25I probably benign Het
Ttn G T 2: 76,919,207 Q3833K probably benign Het
Usp53 G A 3: 122,934,491 P814L probably benign Het
Vmn1r181 G T 7: 23,984,518 S136I possibly damaging Het
Vmn2r114 A T 17: 23,290,974 M844K probably benign Het
Vwa8 G T 14: 78,947,142 R360L probably benign Het
Xlr4b A T X: 73,215,332 Q25L probably null Het
Zfp532 T A 18: 65,656,626 H1045Q possibly damaging Het
Zfp985 G A 4: 147,583,011 W112* probably null Het
Other mutations in Poteg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Poteg APN 8 27473620 splice site probably benign
IGL01964:Poteg APN 8 27448008 missense probably damaging 0.99
IGL03017:Poteg APN 8 27462041 missense probably benign 0.01
R0034:Poteg UTSW 8 27462077 splice site probably benign
R0069:Poteg UTSW 8 27447821 missense probably benign 0.33
R0069:Poteg UTSW 8 27447821 missense probably benign 0.33
R0522:Poteg UTSW 8 27449958 missense possibly damaging 0.95
R0634:Poteg UTSW 8 27473587 missense probably benign 0.20
R0971:Poteg UTSW 8 27447939 missense probably damaging 1.00
R1019:Poteg UTSW 8 27447824 missense possibly damaging 0.46
R1450:Poteg UTSW 8 27447843 missense probably benign 0.27
R1603:Poteg UTSW 8 27448005 start codon destroyed probably null 0.56
R1650:Poteg UTSW 8 27463785 missense probably benign 0.04
R1656:Poteg UTSW 8 27495032 intron probably benign
R1818:Poteg UTSW 8 27450167 nonsense probably null
R2048:Poteg UTSW 8 27456746 missense probably benign 0.39
R2847:Poteg UTSW 8 27481676 missense probably benign 0.10
R2849:Poteg UTSW 8 27481676 missense probably benign 0.10
R4493:Poteg UTSW 8 27480097 missense possibly damaging 0.68
R4967:Poteg UTSW 8 27494981 intron probably benign
R5051:Poteg UTSW 8 27453329 missense possibly damaging 0.78
R5149:Poteg UTSW 8 27481643 missense possibly damaging 0.93
R5579:Poteg UTSW 8 27448037 missense probably damaging 1.00
R5594:Poteg UTSW 8 27447968 missense probably benign 0.28
R5723:Poteg UTSW 8 27449992 critical splice donor site probably null
R5804:Poteg UTSW 8 27456798 missense probably damaging 1.00
R6685:Poteg UTSW 8 27447905 missense possibly damaging 0.91
R6911:Poteg UTSW 8 27450298 missense probably damaging 0.97
R7044:Poteg UTSW 8 27449895 missense probably damaging 1.00
R7096:Poteg UTSW 8 27473567 missense probably benign 0.00
R7174:Poteg UTSW 8 27453277 missense probably benign 0.36
R7287:Poteg UTSW 8 27453344 missense probably null 0.44
R7560:Poteg UTSW 8 27494960 missense probably benign
R7875:Poteg UTSW 8 27449914 missense probably benign 0.04
R7958:Poteg UTSW 8 27449914 missense probably benign 0.04
X0063:Poteg UTSW 8 27450154 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCAGCGCCTTATATACTTAG -3'
(R):5'- GTCAACACAGCTGCTCCAAG -3'

Sequencing Primer
(F):5'- GTTGAAATTCTTAATCAGAAAGGAGC -3'
(R):5'- GATGTCCTGGAACTCACTATGTGAC -3'
Posted On2014-12-04