Mutagenetix > Incidental Mutation

Incidental Mutation 'R2509:Abca17'

251861

Institutional Source

Beutler Lab

Gene Symbol

Abca17

Ensembl Gene

ENSMUSG00000035435

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 17

Synonyms

MMRRC Submission

040415-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2509 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24264259-24351029 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to T at 24289613 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000112538 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039324] [ENSMUST00000121226]

AlphaFold

E9PX95

Predicted Effect

probably benign
Transcript: ENSMUST00000039324

SMART Domains

Protein: ENSMUSP00000046218
Gene: ENSMUSG00000035435

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
transmembrane domain	22	44	N/A	INTRINSIC
Pfam:ABC2_membrane_3	252	464	9.5e-17	PFAM
AAA	547	729	5.71e-12	SMART
low complexity region	846	857	N/A	INTRINSIC
Pfam:ABC2_membrane_3	905	1307	6.7e-35	PFAM
low complexity region	1337	1351	N/A	INTRINSIC
AAA	1393	1577	1.15e-1	SMART
low complexity region	1697	1730	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000121226

SMART Domains

Protein: ENSMUSP00000112538
Gene: ENSMUSG00000035435

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
Pfam:ABC2_membrane_3	21	464	1.2e-15	PFAM
AAA	547	729	5.71e-12	SMART
low complexity region	846	857	N/A	INTRINSIC
Pfam:ABC2_membrane_3	905	1307	1.1e-32	PFAM
low complexity region	1337	1351	N/A	INTRINSIC
AAA	1393	1577	1.15e-1	SMART
low complexity region	1697	1730	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

96% (105/109)

Allele List at MGI

Other mutations in this stock

Total: 108 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	T	C	3: 124,406,453	I497V	probably benign	Het
2010300C02Rik	T	C	1: 37,625,300	M506V	probably benign	Het
4930571K23Rik	C	A	7: 125,369,139		noncoding transcript	Het
Ablim1	C	T	19: 57,152,359	R196Q	probably damaging	Het
Acot11	T	C	4: 106,755,319	I379V	possibly damaging	Het
Acot4	G	A	12: 84,041,873	G165D	probably damaging	Het
Agrn	A	T	4: 156,166,424		probably null	Het
Ahctf1	T	C	1: 179,770,693	S945G	possibly damaging	Het
Akr1c13	C	T	13: 4,198,584	R263C	probably damaging	Het
Arfgap1	T	A	2: 180,974,053		probably benign	Het
Arhgef3	A	G	14: 27,379,676	K103R	probably damaging	Het
Cabp1	A	T	5: 115,172,784	N211K	probably damaging	Het
Cacna1c	T	A	6: 118,734,982	D261V	probably damaging	Het
Car11	G	A	7: 45,701,359	G93E	probably damaging	Het
Card10	A	G	15: 78,780,273	I821T	probably benign	Het
Cast	T	C	13: 74,737,616	I277V	probably benign	Het
Cenpj	T	C	14: 56,532,237	K1165R	probably null	Het
Cenpk	A	G	13: 104,234,167		probably null	Het
Cmya5	T	C	13: 93,093,558	Q1674R	probably benign	Het
Cnnm1	T	A	19: 43,441,886	V481D	probably damaging	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Cyp2c50	G	A	19: 40,090,569	V119I	probably benign	Het
Dnah7b	A	G	1: 46,195,287	T1460A	probably damaging	Het
Dnah8	G	A	17: 30,775,045	D3379N	probably benign	Het
Dnajc4	C	T	19: 6,990,743	R55H	probably damaging	Het
Ebf4	C	T	2: 130,306,562	R98*	probably null	Het
Epha4	G	A	1: 77,511,702	A47V	possibly damaging	Het
Ercc8	T	C	13: 108,183,717		probably benign	Het
Exo1	T	C	1: 175,905,833	F75S	probably damaging	Het
Fam168a	G	T	7: 100,834,184		probably null	Het
Fat3	G	A	9: 15,925,014	R4065W	possibly damaging	Het
Gm10639	T	A	9: 78,294,807	M1K	probably null	Het
Gm13103	G	A	4: 143,851,991	V274I	probably benign	Het
Gm5431	T	A	11: 48,888,709	N740I	probably benign	Het
Gm5900	T	A	7: 104,950,364		noncoding transcript	Het
Gpi1	A	G	7: 34,205,923	S359P	probably damaging	Het
Gpr156	A	G	16: 37,947,787	R22G	probably benign	Het
Greb1	A	G	12: 16,724,922	V158A	probably damaging	Het
Grin2c	T	A	11: 115,251,068	K842*	probably null	Het
Hnf4a	T	A	2: 163,566,241	L329Q	probably damaging	Het
Hsp90ab1	A	G	17: 45,569,341	L92P	probably damaging	Het
Ido1	T	A	8: 24,584,485	R290*	probably null	Het
Ifnlr1	G	T	4: 135,705,248	D332Y	probably damaging	Het
Ift172	T	C	5: 31,262,968	N1108S	probably benign	Het
Igkv3-9	T	A	6: 70,588,744	M109K	probably benign	Het
Igsf10	T	C	3: 59,331,866	D298G	probably damaging	Het
Iqck	T	G	7: 118,876,282	M98R	probably benign	Het
Klk1b1	T	C	7: 43,969,379	V60A	probably damaging	Het
Krtap1-3	C	T	11: 99,590,827	E165K	unknown	Het
Lair1	A	G	7: 4,010,783	L155P	probably damaging	Het
Mast4	G	T	13: 102,853,842	S57Y	probably damaging	Het
Mical3	T	C	6: 121,034,157	H360R	probably damaging	Het
Muc5b	A	T	7: 141,859,061	N1915Y	unknown	Het
Myh1	A	G	11: 67,205,597	I301V	probably benign	Het
Nck2	T	A	1: 43,554,233	V200E	probably damaging	Het
Olfr10	T	G	11: 49,318,221	L225R	probably damaging	Het
Olfr1214	T	G	2: 88,987,431	Y257S	probably damaging	Het
Olfr1271	T	C	2: 90,265,686	Y248C	possibly damaging	Het
Olfr1282	C	T	2: 111,335,731	V116I	probably damaging	Het
Olfr1313	T	A	2: 112,072,492	L30F	probably benign	Het
Olfr1453	T	A	19: 13,027,694	I212F	probably damaging	Het
Olfr668	G	A	7: 104,925,687	H26Y	probably benign	Het
Olfr870	A	G	9: 20,171,229	L114P	probably damaging	Het
Otoa	C	T	7: 121,160,472	T1099I	probably benign	Het
Pask	T	A	1: 93,330,763	I288F	possibly damaging	Het
Pcnx4	T	C	12: 72,566,972	W564R	probably damaging	Het
Pitpnm2	T	C	5: 124,136,326	E240G	probably damaging	Het
Ppp1r16b	A	G	2: 158,761,463	Y436C	possibly damaging	Het
Prkca	T	C	11: 107,979,206	Y37C	probably damaging	Het
Rad18	T	G	6: 112,675,922	H238P	possibly damaging	Het
Rap1b	T	A	10: 117,818,539	Q1L	probably damaging	Het
Rgs9	T	C	11: 109,268,972	Y178C	probably benign	Het
Rpl3l	A	T	17: 24,732,386	D87V	possibly damaging	Het
Scrn2	T	C	11: 97,033,166	V292A	possibly damaging	Het
Sdad1	A	G	5: 92,305,825	Y35H	probably benign	Het
Sez6l2	T	C	7: 126,953,772	S177P	probably benign	Het
Sh3bp1	C	T	15: 78,911,506	P612S	probably damaging	Het
Shank1	T	C	7: 44,351,724	S956P	unknown	Het
Shank1	G	A	7: 44,352,123	A1089T	unknown	Het
Shprh	G	A	10: 11,166,724	C817Y	probably damaging	Het
Spata22	C	T	11: 73,345,767	P300S	probably damaging	Het
Sstr2	A	T	11: 113,624,923	I223F	probably damaging	Het
Stom	C	T	2: 35,320,342	A217T	probably damaging	Het
Stpg1	T	C	4: 135,536,649	V341A	probably benign	Het
Tagap	A	G	17: 7,928,754	T99A	probably benign	Het
Tas1r2	A	G	4: 139,659,851	N207S	probably damaging	Het
Thbs2	A	G	17: 14,685,843	V265A	probably benign	Het
Thyn1	A	G	9: 27,000,020	R3G	possibly damaging	Het
Tia1	T	A	6: 86,424,330		probably null	Het
Tktl2	A	G	8: 66,512,852	E354G	probably benign	Het
Tmc8	A	G	11: 117,792,685	T689A	possibly damaging	Het
Tmem11	A	T	11: 60,864,981		probably null	Het
Tmem55b	A	T	14: 50,929,658	Y129*	probably null	Het
Tmem57	A	G	4: 134,804,388	S657P	probably damaging	Het
Tnik	T	C	3: 28,667,915	V1310A	probably damaging	Het
Trappc10	A	G	10: 78,211,523	S380P	possibly damaging	Het
Trim8	C	T	19: 46,515,295	P429S	probably benign	Het
Ttc25	T	G	11: 100,553,535	L222R	probably damaging	Het
Ttn	C	A	2: 76,857,412		probably benign	Het
Ulk2	T	C	11: 61,787,514	Y793C	probably benign	Het
Vill	G	A	9: 119,070,302	V337M	possibly damaging	Het
Vps53	C	A	11: 76,066,835	V364F	possibly damaging	Het
Wdr66	A	G	5: 123,256,106	K353E	probably benign	Het
Zan	A	T	5: 137,456,586	I1396N	unknown	Het
Zfa-ps	A	C	10: 52,544,243		noncoding transcript	Het
Zfp426	T	C	9: 20,470,681	T337A	possibly damaging	Het
Zfp536	T	C	7: 37,567,978	E671G	possibly damaging	Het
Zfp985	A	G	4: 147,582,986	T104A	possibly damaging	Het

Other mutations in Abca17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Abca17	APN	17	24295191	missense	probably benign	0.14
IGL00585:Abca17	APN	17	24300320	missense	probably damaging	0.99
IGL00941:Abca17	APN	17	24317130	missense	probably damaging	1.00
IGL01987:Abca17	APN	17	24346228	missense	probably benign	0.00
IGL01988:Abca17	APN	17	24334255	missense	probably damaging	0.99
IGL02223:Abca17	APN	17	24287935	nonsense	probably null
IGL02368:Abca17	APN	17	24287793	missense	probably benign	0.01
IGL02405:Abca17	APN	17	24279062	missense	possibly damaging	0.80
IGL02431:Abca17	APN	17	24298984	missense	probably benign	0.05
IGL02607:Abca17	APN	17	24327705	nonsense	probably null
IGL02706:Abca17	APN	17	24298992	missense	probably benign	0.00
IGL02729:Abca17	APN	17	24280481	missense	probably benign	0.06
IGL02818:Abca17	APN	17	24300352	missense	probably benign	0.02
IGL02891:Abca17	APN	17	24281366	missense	probably damaging	0.99
IGL03236:Abca17	APN	17	24326476	splice site	probably benign
IGL03299:Abca17	APN	17	24265591	missense	probably damaging	1.00
basin	UTSW	17	24318185	missense	probably benign	0.01
Bowl	UTSW	17	24317238	missense	probably benign	0.09
R0018:Abca17	UTSW	17	24313188	splice site	probably null
R0467:Abca17	UTSW	17	24313177	splice site	probably benign
R0671:Abca17	UTSW	17	24281249	missense	probably benign	0.00
R1175:Abca17	UTSW	17	24289351	missense	possibly damaging	0.91
R1397:Abca17	UTSW	17	24285759	missense	probably benign	0.18
R1398:Abca17	UTSW	17	24328537	missense	probably damaging	0.96
R1678:Abca17	UTSW	17	24335620	missense	probably benign	0.05
R1696:Abca17	UTSW	17	24267658	missense	possibly damaging	0.90
R1781:Abca17	UTSW	17	24267557	missense	possibly damaging	0.95
R1845:Abca17	UTSW	17	24267716	missense	probably damaging	1.00
R1970:Abca17	UTSW	17	24307575	missense	probably benign	0.00
R1997:Abca17	UTSW	17	24285726	missense	probably benign	0.02
R2141:Abca17	UTSW	17	24334266	missense	probably benign	0.00
R2199:Abca17	UTSW	17	24335624	missense	probably benign	0.19
R2394:Abca17	UTSW	17	24281216	splice site	probably null
R2442:Abca17	UTSW	17	24328632	missense	probably benign	0.02
R2848:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R2849:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R2859:Abca17	UTSW	17	24281314	missense	possibly damaging	0.46
R2879:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R2935:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R3153:Abca17	UTSW	17	24328746	missense	probably damaging	1.00
R3154:Abca17	UTSW	17	24328746	missense	probably damaging	1.00
R3434:Abca17	UTSW	17	24289537	missense	probably damaging	1.00
R3695:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R3905:Abca17	UTSW	17	24296283	missense	probably benign	0.13
R4282:Abca17	UTSW	17	24299060	missense	possibly damaging	0.49
R4334:Abca17	UTSW	17	24318268	missense	probably damaging	1.00
R4350:Abca17	UTSW	17	24279046	critical splice donor site	probably null
R4548:Abca17	UTSW	17	24334271	missense	possibly damaging	0.82
R4626:Abca17	UTSW	17	24321084	missense	probably damaging	1.00
R4722:Abca17	UTSW	17	24265429	missense	probably damaging	1.00
R4745:Abca17	UTSW	17	24307453	missense	probably damaging	1.00
R4818:Abca17	UTSW	17	24317161	missense	probably damaging	0.98
R5279:Abca17	UTSW	17	24289414	missense	probably damaging	1.00
R5310:Abca17	UTSW	17	24281230	missense	probably benign	0.00
R5320:Abca17	UTSW	17	24307567	missense	probably damaging	1.00
R5435:Abca17	UTSW	17	24267614	missense	possibly damaging	0.90
R5622:Abca17	UTSW	17	24327668	missense	probably benign	0.14
R5776:Abca17	UTSW	17	24295158	missense	probably benign	0.09
R5928:Abca17	UTSW	17	24318185	missense	probably benign	0.01
R6013:Abca17	UTSW	17	24287846	missense	possibly damaging	0.79
R6035:Abca17	UTSW	17	24281245	missense	possibly damaging	0.79
R6035:Abca17	UTSW	17	24281245	missense	possibly damaging	0.79
R6052:Abca17	UTSW	17	24318191	missense	probably benign	0.00
R6063:Abca17	UTSW	17	24264344	missense	unknown
R6404:Abca17	UTSW	17	24265918	missense	probably benign	0.13
R6746:Abca17	UTSW	17	24346221	nonsense	probably null
R6819:Abca17	UTSW	17	24287793	missense	probably benign	0.01
R6828:Abca17	UTSW	17	24326415	missense	possibly damaging	0.91
R7043:Abca17	UTSW	17	24265500	missense	probably damaging	1.00
R7065:Abca17	UTSW	17	24327751	missense	probably damaging	1.00
R7123:Abca17	UTSW	17	24265975	missense	probably damaging	1.00
R7157:Abca17	UTSW	17	24335590	missense	possibly damaging	0.46
R7188:Abca17	UTSW	17	24335626	missense	possibly damaging	0.89
R7294:Abca17	UTSW	17	24321009	missense	not run
R7352:Abca17	UTSW	17	24289054	nonsense	probably null
R7355:Abca17	UTSW	17	24267647	missense	probably benign	0.00
R7358:Abca17	UTSW	17	24291555	missense	probably benign	0.00
R7411:Abca17	UTSW	17	24328569	missense	possibly damaging	0.52
R7915:Abca17	UTSW	17	24265533	missense	probably damaging	1.00
R8039:Abca17	UTSW	17	24328725	missense	probably damaging	1.00
R8095:Abca17	UTSW	17	24317222	missense	possibly damaging	0.77
R8308:Abca17	UTSW	17	24267683	missense	probably damaging	1.00
R8517:Abca17	UTSW	17	24317233	missense	probably benign	0.00
R8811:Abca17	UTSW	17	24317238	missense	probably benign	0.09
R8819:Abca17	UTSW	17	24328602	missense	probably damaging	1.00
R8820:Abca17	UTSW	17	24328602	missense	probably damaging	1.00
R8953:Abca17	UTSW	17	24299041	missense	probably benign
R9095:Abca17	UTSW	17	24281396	missense	probably damaging	0.97
R9313:Abca17	UTSW	17	24346233	missense	probably benign	0.00
R9314:Abca17	UTSW	17	24328619	missense	possibly damaging	0.91
R9347:Abca17	UTSW	17	24264505	missense	probably benign
R9351:Abca17	UTSW	17	24291777	missense	probably benign	0.00
R9387:Abca17	UTSW	17	24334281	missense	probably benign	0.02
R9388:Abca17	UTSW	17	24264299	missense	unknown
R9440:Abca17	UTSW	17	24280478	missense	probably benign	0.02
R9498:Abca17	UTSW	17	24265506	missense	probably damaging	1.00
R9654:Abca17	UTSW	17	24317125	missense	probably benign	0.09
R9709:Abca17	UTSW	17	24298960	missense	probably benign
R9770:Abca17	UTSW	17	24295147	missense	probably benign	0.00
R9773:Abca17	UTSW	17	24289591	missense	probably damaging	1.00
RF024:Abca17	UTSW	17	24287732	frame shift	probably null
RF029:Abca17	UTSW	17	24287727	critical splice donor site	probably benign
RF032:Abca17	UTSW	17	24287727	frame shift	probably null
RF036:Abca17	UTSW	17	24287727	critical splice donor site	probably benign
X0017:Abca17	UTSW	17	24317163	missense	probably benign	0.26
X0065:Abca17	UTSW	17	24334284	missense	probably damaging	1.00
Z1088:Abca17	UTSW	17	24279079	missense	probably damaging	0.96
Z1088:Abca17	UTSW	17	24279107	missense	probably benign	0.03
Z1088:Abca17	UTSW	17	24346219	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GGCTCCAGAAAGCAACTTGAAG -3'
(R):5'- AGATTTGGAGAGATCGGCTG -3'

Sequencing Primer
(F):5'- ACTTGAAGAGAAGATTGTCCACC -3'
(R):5'- TCGGCTGGAATTCAATAGAGAGCTG -3'

Posted On

2014-12-04