Mutagenetix > Incidental Mutation

Incidental Mutation 'R2848:Naa16'

251873

Institutional Source

Beutler Lab

Gene Symbol

Naa16

Ensembl Gene

ENSMUSG00000022020

Gene Name

N(alpha)-acetyltransferase 16, NatA auxiliary subunit

Synonyms

Narg1l, 1300019C06Rik

MMRRC Submission

040441-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R2848 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

79325269-79390778 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 79335883 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 816 (C816R)

Ref Sequence

ENSEMBL: ENSMUSP00000022597 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022597]

AlphaFold

Q9DBB4

Predicted Effect

probably damaging
Transcript: ENSMUST00000022597
AA Change: C816R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000022597
Gene: ENSMUSG00000022020
AA Change: C816R

Domain	Start	End	E-Value	Type
TPR	46	79	2.99e1	SMART
TPR	80	113	2.98e-3	SMART
Blast:TPR	224	257	1e-10	BLAST
TPR	374	407	9.96e0	SMART
TPR	408	441	7.47e0	SMART
low complexity region	616	633	N/A	INTRINSIC
Blast:TPR	672	705	3e-12	BLAST
low complexity region	830	841	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171928

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227775

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930451I11Rik	A	T	7: 126,830,722	F101Y	possibly damaging	Het
A230050P20Rik	A	T	9: 20,873,572	H225L	probably damaging	Het
Abca17	G	C	17: 24,289,507	T1018R	probably damaging	Het
Adamts14	T	A	10: 61,218,435	Q606L	probably damaging	Het
Adgrf5	C	A	17: 43,422,640	N118K	possibly damaging	Het
Baz2b	A	T	2: 59,924,666	Y1073N	possibly damaging	Het
Celf2	T	C	2: 6,604,125	R282G	probably damaging	Het
Cntnap5c	A	T	17: 57,876,392	D31V	probably damaging	Het
Cobl	A	G	11: 12,378,342	L81P	probably damaging	Het
Cpsf1	A	T	15: 76,602,851	L209Q	probably damaging	Het
Crocc	G	A	4: 141,018,756	A1684V	probably damaging	Het
Cyp4f37	T	A	17: 32,629,125	C206S	probably damaging	Het
Diexf	A	T	1: 193,128,451	N81K	probably benign	Het
Dnah3	A	G	7: 119,967,938	V2355A	probably benign	Het
Dnah6	T	C	6: 73,129,331	K1756E	probably benign	Het
Fis1	T	C	5: 136,963,117	I55T	possibly damaging	Het
Gm2381	G	A	7: 42,820,407	P98S	probably damaging	Het
Gpr37	C	T	6: 25,666,946		probably benign	Het
Grin2a	A	G	16: 9,761,965	F145L	possibly damaging	Het
Htr4	T	C	18: 62,428,126	S153P	probably damaging	Het
Igkv9-120	T	A	6: 68,050,144		probably benign	Het
Il12rb1	G	A	8: 70,815,802	W396*	probably null	Het
Itga8	A	T	2: 12,160,404	V798D	probably damaging	Het
Lfng	T	A	5: 140,611,867	D149E	probably damaging	Het
Magi2	A	AG	5: 20,602,461		probably null	Het
Mgam	C	A	6: 40,652,715	A86E	possibly damaging	Het
Myh4	A	G	11: 67,248,633	N592S	probably benign	Het
Nek8	A	G	11: 78,168,141	S513P	probably damaging	Het
Ociad1	A	G	5: 73,294,351		probably null	Het
Olfr1288	T	C	2: 111,479,354	M190T	probably benign	Het
Olfr350	A	G	2: 36,850,799	Y251C	probably damaging	Het
Olfr721-ps1	C	T	14: 14,407,398	P57S	probably damaging	Het
Osbpl8	T	A	10: 111,269,436	S251T	probably benign	Het
Pcdh7	G	A	5: 57,720,276	G391E	probably damaging	Het
Pcdhga10	T	A	18: 37,748,200	V338E	possibly damaging	Het
Pde4b	C	T	4: 102,601,545	A466V	probably damaging	Het
Peg10	C	T	6: 4,756,912		probably benign	Het
Poteg	A	T	8: 27,481,676	N406I	probably benign	Het
Ppargc1a	A	G	5: 51,473,809	F493L	probably benign	Het
Ptpra	C	A	2: 130,544,999	H603Q	probably benign	Het
Rnf10	T	C	5: 115,249,112	D439G	probably benign	Het
Syt3	G	A	7: 44,393,442	V383I	probably benign	Het
Tectb	C	G	19: 55,180,999		probably benign	Het
Try5	C	T	6: 41,313,476	V25I	probably benign	Het
Ttn	G	T	2: 76,919,207	Q3833K	probably benign	Het
Usp53	G	A	3: 122,934,491	P814L	probably benign	Het
Vmn1r181	G	T	7: 23,984,518	S136I	possibly damaging	Het
Vmn2r114	A	T	17: 23,290,974	M844K	probably benign	Het
Vwa8	G	T	14: 78,947,142	R360L	probably benign	Het
Xlr4b	A	T	X: 73,215,332	Q25L	probably null	Het
Zfp532	T	A	18: 65,656,626	H1045Q	possibly damaging	Het
Zfp985	G	A	4: 147,583,011	W112*	probably null	Het

Other mutations in Naa16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00551:Naa16	APN	14	79355729	missense	probably damaging	1.00
IGL01025:Naa16	APN	14	79384756	missense	probably damaging	1.00
IGL01155:Naa16	APN	14	79384715	missense	probably damaging	0.98
IGL01335:Naa16	APN	14	79345116	splice site	probably benign
IGL01981:Naa16	APN	14	79381516	missense	probably benign	0.05
IGL02230:Naa16	APN	14	79377361	splice site	probably benign
IGL02313:Naa16	APN	14	79384668	missense	probably damaging	1.00
IGL02418:Naa16	APN	14	79383366	missense	probably damaging	1.00
IGL02544:Naa16	APN	14	79335820	missense	probably damaging	1.00
IGL03051:Naa16	APN	14	79369082	missense	probably benign	0.01
IGL03064:Naa16	APN	14	79339628	missense	probably damaging	0.98
IGL03205:Naa16	APN	14	79356512	missense	possibly damaging	0.89
PIT4508001:Naa16	UTSW	14	79369087	missense	probably benign	0.15
R0651:Naa16	UTSW	14	79351392	missense	probably damaging	1.00
R1429:Naa16	UTSW	14	79359527	missense	probably benign	0.01
R1674:Naa16	UTSW	14	79387057	start codon destroyed	probably null	0.65
R1693:Naa16	UTSW	14	79351456	missense	probably damaging	1.00
R1874:Naa16	UTSW	14	79355743	missense	possibly damaging	0.62
R1992:Naa16	UTSW	14	79356491	missense	probably damaging	1.00
R2015:Naa16	UTSW	14	79345059	missense	probably damaging	1.00
R2391:Naa16	UTSW	14	79370049	missense	probably benign	0.16
R2847:Naa16	UTSW	14	79335883	missense	probably damaging	1.00
R2877:Naa16	UTSW	14	79343298	missense	probably benign	0.00
R3884:Naa16	UTSW	14	79343262	missense	probably damaging	0.98
R4001:Naa16	UTSW	14	79343121	splice site	probably null
R4199:Naa16	UTSW	14	79355871	missense	probably damaging	1.00
R4638:Naa16	UTSW	14	79340033	splice site	probably null
R4676:Naa16	UTSW	14	79336348	unclassified	probably benign
R4690:Naa16	UTSW	14	79345057	missense	probably damaging	1.00
R4952:Naa16	UTSW	14	79345085	missense	probably damaging	1.00
R5087:Naa16	UTSW	14	79377415	missense	possibly damaging	0.68
R5104:Naa16	UTSW	14	79384700	nonsense	probably null
R5729:Naa16	UTSW	14	79355780	missense	probably damaging	1.00
R6178:Naa16	UTSW	14	79383340	missense	possibly damaging	0.93
R6960:Naa16	UTSW	14	79359471	missense	possibly damaging	0.65
R7794:Naa16	UTSW	14	79377494	missense	probably damaging	1.00
R7936:Naa16	UTSW	14	79341046	missense	possibly damaging	0.47
R8356:Naa16	UTSW	14	79359475	missense	probably benign	0.00
R8456:Naa16	UTSW	14	79359475	missense	probably benign	0.00
R8892:Naa16	UTSW	14	79390576	missense	probably benign	0.32
R8931:Naa16	UTSW	14	79344955	missense	probably damaging	1.00
R9010:Naa16	UTSW	14	79370042	missense	probably benign	0.01
R9068:Naa16	UTSW	14	79374849	missense	probably benign	0.18
R9360:Naa16	UTSW	14	79356503	missense	probably benign	0.05
R9688:Naa16	UTSW	14	79335869	nonsense	probably null
X0064:Naa16	UTSW	14	79351389	missense	probably damaging	1.00
Z1177:Naa16	UTSW	14	79344979	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTAGGAGCAACTTCCCACAAGATTC -3'
(R):5'- ATTGGAATCCTGCGTCACCC -3'

Sequencing Primer
(F):5'- GCAACTTCCCACAAGATTCAAATTTC -3'
(R):5'- TGGGCCTCCATAACCAGCTC -3'

Posted On

2014-12-04