Mutagenetix > Incidental Mutations

Incidental Mutation 'R0310:Nbeal2'

25188

Institutional Source

Beutler Lab

Gene Symbol

Nbeal2

Ensembl Gene

ENSMUSG00000056724

Gene Name

neurobeachin-like 2

Synonyms

1110014F23Rik

MMRRC Submission

038520-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.287) question?

Stock #

R0310 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

110624789-110654161 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 110638163 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 653 (V653L)

Ref Sequence

ENSEMBL: ENSMUSP00000128586 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000133191] [ENSMUST00000149089] [ENSMUST00000167320] [ENSMUST00000196488]

Predicted Effect

probably benign
Transcript: ENSMUST00000123996

Predicted Effect

probably benign
Transcript: ENSMUST00000130024
AA Change: V125L

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000118061
Gene: ENSMUSG00000056724
AA Change: V125L

Domain	Start	End	E-Value	Type
low complexity region	1	13	N/A	INTRINSIC
low complexity region	236	248	N/A	INTRINSIC
Pfam:DUF4704	345	607	2.5e-29	PFAM
low complexity region	649	664	N/A	INTRINSIC
low complexity region	804	819	N/A	INTRINSIC
Pfam:DUF4800	872	1138	9.9e-113	PFAM
low complexity region	1164	1193	N/A	INTRINSIC
Pfam:PH_BEACH	1204	1291	2.2e-21	PFAM
Beach	1343	1623	5.2e-205	SMART
WD40	1721	1766	1.03e1	SMART
WD40	1769	1808	6.19e-5	SMART
WD40	1820	1859	1.02e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000133191
AA Change: V653L

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000121373
Gene: ENSMUSG00000056724
AA Change: V653L

Domain	Start	End	E-Value	Type
low complexity region	56	84	N/A	INTRINSIC
low complexity region	192	201	N/A	INTRINSIC
low complexity region	227	238	N/A	INTRINSIC
low complexity region	514	522	N/A	INTRINSIC
low complexity region	527	542	N/A	INTRINSIC
Pfam:Laminin_G_3	578	818	5.9e-8	PFAM
low complexity region	1014	1028	N/A	INTRINSIC
low complexity region	1128	1136	N/A	INTRINSIC
low complexity region	1149	1163	N/A	INTRINSIC
low complexity region	1359	1375	N/A	INTRINSIC
low complexity region	1515	1530	N/A	INTRINSIC
low complexity region	1621	1647	N/A	INTRINSIC
low complexity region	1875	1904	N/A	INTRINSIC
Pfam:PH_BEACH	1908	2002	6.2e-28	PFAM
Beach	2054	2334	5.2e-205	SMART
WD40	2432	2477	1.03e1	SMART
WD40	2480	2519	6.19e-5	SMART
WD40	2531	2570	1.02e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000149089

SMART Domains

Protein: ENSMUSP00000119254
Gene: ENSMUSG00000056724

Domain	Start	End	E-Value	Type
low complexity region	49	77	N/A	INTRINSIC
low complexity region	185	194	N/A	INTRINSIC
low complexity region	220	231	N/A	INTRINSIC
low complexity region	480	488	N/A	INTRINSIC
low complexity region	493	508	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153960

Predicted Effect

probably damaging
Transcript: ENSMUST00000167320
AA Change: V653L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128586
Gene: ENSMUSG00000056724
AA Change: V653L

Domain	Start	End	E-Value	Type
low complexity region	56	84	N/A	INTRINSIC
low complexity region	192	201	N/A	INTRINSIC
low complexity region	227	238	N/A	INTRINSIC
low complexity region	514	522	N/A	INTRINSIC
low complexity region	527	542	N/A	INTRINSIC
low complexity region	763	775	N/A	INTRINSIC
Pfam:DUF4704	872	1148	9.2e-32	PFAM
low complexity region	1149	1163	N/A	INTRINSIC
low complexity region	1366	1382	N/A	INTRINSIC
low complexity region	1522	1537	N/A	INTRINSIC
Pfam:DUF4800	1590	1856	1.5e-112	PFAM
low complexity region	1882	1911	N/A	INTRINSIC
Pfam:PH_BEACH	1922	2009	3.1e-21	PFAM
Beach	2061	2341	5.2e-205	SMART
WD40	2439	2484	1.03e1	SMART
WD40	2487	2526	6.19e-5	SMART
WD40	2538	2577	1.02e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184024

Predicted Effect

probably damaging
Transcript: ENSMUST00000196488
AA Change: V626L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000143265
Gene: ENSMUSG00000056724
AA Change: V626L

Domain	Start	End	E-Value	Type
low complexity region	56	84	N/A	INTRINSIC
low complexity region	192	201	N/A	INTRINSIC
low complexity region	227	238	N/A	INTRINSIC
low complexity region	487	495	N/A	INTRINSIC
low complexity region	500	515	N/A	INTRINSIC
Pfam:Laminin_G_3	551	791	5.3e-6	PFAM
low complexity region	987	1001	N/A	INTRINSIC
low complexity region	1101	1109	N/A	INTRINSIC
low complexity region	1122	1136	N/A	INTRINSIC
low complexity region	1332	1348	N/A	INTRINSIC
low complexity region	1488	1503	N/A	INTRINSIC
low complexity region	1594	1620	N/A	INTRINSIC
low complexity region	1848	1877	N/A	INTRINSIC
Pfam:PH_BEACH	1881	1975	3.1e-25	PFAM
Beach	2027	2307	3.8e-209	SMART
WD40	2405	2450	6.3e-2	SMART
WD40	2453	2492	3.8e-7	SMART
WD40	2504	2543	6.5e-8	SMART

Meta Mutation Damage Score

0.2425

Coding Region Coverage

1x: 98.6%
3x: 97.3%
10x: 93.3%
20x: 82.5%

Validation Efficiency

99% (113/114)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a beige and Chediak-Higashi (BEACH) domain and multiple WD40 domains, and may play a role in megakaryocyte alpha-granule biogenesis. Mutations in this gene are a cause of gray platelet syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mice exhibit megakaryocyte and platelet abnormalities resulting in impaired arterial thrombus formation and protection from infarction following cerebral ischemia. Wound repair is impaired. These abnormalities result in a bleeding disorder similiar to Gray Platelet Syndrome. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 109 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930550C14Rik	A	C	9: 53,425,671	T92P	probably damaging	Het
9530053A07Rik	G	T	7: 28,142,274	V545L	probably benign	Het
Abca13	T	C	11: 9,293,810	V1891A	probably benign	Het
Abcc1	T	A	16: 14,410,927	I346N	probably damaging	Het
Afdn	G	T	17: 13,885,508		probably null	Het
Ahrr	G	A	13: 74,283,024		probably benign	Het
Akap13	A	G	7: 75,614,930	D507G	probably damaging	Het
Akap8	A	T	17: 32,316,260	M260K	possibly damaging	Het
Akr1b8	T	C	6: 34,365,259	V265A	probably benign	Het
Alpk3	C	G	7: 81,078,610	P496R	possibly damaging	Het
Ankrd13b	A	G	11: 77,472,745	V249A	possibly damaging	Het
Arid4a	T	C	12: 71,075,830	V995A	probably benign	Het
Ascc3	G	T	10: 50,748,926	V1637L	probably benign	Het
Atad2	G	A	15: 58,114,257	A499V	probably damaging	Het
Barhl2	G	T	5: 106,457,387	A152E	possibly damaging	Het
Bbs12	T	A	3: 37,321,045	D547E	probably damaging	Het
Btaf1	A	G	19: 37,004,534	M1655V	probably damaging	Het
Ccdc50	T	A	16: 27,406,658	H40Q	probably damaging	Het
Ccr9	A	T	9: 123,774,552		probably benign	Het
Cdh15	A	G	8: 122,865,436	D654G	probably damaging	Het
Cebpz	T	C	17: 78,926,124	D758G	probably damaging	Het
Cgn	C	T	3: 94,765,653	R906K	possibly damaging	Het
Chil3	T	A	3: 106,160,523	M109L	possibly damaging	Het
Cntnap4	A	T	8: 112,842,516		probably null	Het
Cyp4f18	C	T	8: 72,001,012		probably benign	Het
Daam2	A	G	17: 49,463,924		probably null	Het
Ddost	T	A	4: 138,310,611	H220Q	probably benign	Het
Dennd2a	C	T	6: 39,464,201		probably benign	Het
Depdc1b	G	A	13: 108,373,841	V296I	possibly damaging	Het
Dnah5	A	T	15: 28,299,110	R1539S	probably benign	Het
Dusp22	T	C	13: 30,705,658	I74T	probably damaging	Het
Dyx1c1	A	T	9: 72,972,336	D386V	probably damaging	Het
E130309D02Rik	G	T	5: 143,307,888	T278K	probably benign	Het
Epc1	A	G	18: 6,440,202		probably benign	Het
Epha7	A	G	4: 28,961,301	I845V	probably benign	Het
Fanci	C	T	7: 79,407,417		probably benign	Het
Fbn1	T	A	2: 125,363,644	E1104V	probably damaging	Het
Fbxo8	T	A	8: 56,590,097	F205L	probably damaging	Het
Fetub	T	C	16: 22,929,756		probably benign	Het
Frs3	T	C	17: 47,703,822	V480A	probably benign	Het
Gne	C	A	4: 44,060,157	E79*	probably null	Het
Hrc	T	A	7: 45,336,497	H357Q	probably benign	Het
Idh1	T	C	1: 65,161,920	M291V	probably damaging	Het
Iltifb	T	A	10: 118,293,185	H133L	probably benign	Het
Ino80b	T	C	6: 83,124,091	E165G	probably damaging	Het
Inppl1	A	T	7: 101,828,499		probably benign	Het
Ip6k2	T	C	9: 108,799,233		probably benign	Het
Itga11	A	T	9: 62,760,346	I654F	probably damaging	Het
Jag2	G	T	12: 112,913,377		probably benign	Het
Katna1	G	T	10: 7,743,749		probably benign	Het
Kcnh4	G	T	11: 100,746,169	S707Y	probably benign	Het
Kcnn2	T	G	18: 45,560,518	L387R	probably damaging	Het
Khnyn	A	G	14: 55,887,968	T503A	probably damaging	Het
Lama5	G	T	2: 180,181,566		probably benign	Het
Lmbr1l	A	T	15: 98,908,773		probably benign	Het
Mast4	A	T	13: 102,754,161	S870T	possibly damaging	Het
Med1	A	G	11: 98,167,574	Y266H	probably benign	Het
Med13	A	T	11: 86,346,003	N109K	probably benign	Het
Mgam	T	C	6: 40,761,035		probably benign	Het
Mmp8	A	G	9: 7,561,454	Q153R	probably benign	Het
Mpeg1	C	A	19: 12,461,691	T171N	probably benign	Het
Mtus2	T	C	5: 148,107,019	S806P	probably benign	Het
Naip2	T	A	13: 100,148,842	E1226V	probably damaging	Het
Naip6	A	G	13: 100,308,213	F246L	possibly damaging	Het
Nav3	T	C	10: 109,767,128	I1187V	possibly damaging	Het
Nbeal1	T	C	1: 60,305,370		probably benign	Het
Ndufa9	G	T	6: 126,827,532		probably benign	Het
Nlrp5	G	T	7: 23,430,157	C883F	probably damaging	Het
Nr0b2	C	A	4: 133,555,992		probably null	Het
Olfr24	T	A	9: 18,755,333	M101L	possibly damaging	Het
Olfr799	T	A	10: 129,647,731	V201E	probably damaging	Het
Olfr822	G	A	10: 130,074,823	V138I	probably benign	Het
Olfr888	T	A	9: 38,109,486	S267T	possibly damaging	Het
Pkhd1	A	T	1: 20,549,822		probably null	Het
Pkhd1l1	A	G	15: 44,522,738		probably benign	Het
Ppm1l	A	G	3: 69,549,461	K237R	probably benign	Het
Ppp1r18	T	C	17: 35,873,711		probably benign	Het
Ptpn3	A	T	4: 57,204,958	D734E	probably benign	Het
Pxdn	T	C	12: 30,015,529	C1283R	probably damaging	Het
Rbm12	A	G	2: 156,095,724		probably benign	Het
Rttn	A	T	18: 89,009,460		probably benign	Het
Sgsm1	G	T	5: 113,263,705	H431Q	probably benign	Het
Siah3	A	G	14: 75,525,927	N206S	possibly damaging	Het
Slc22a15	G	T	3: 101,860,511	D521E	probably benign	Het
Sprr2k	A	T	3: 92,433,463		probably benign	Het
Stab2	G	A	10: 86,967,613		probably benign	Het
Sval3	T	A	6: 41,968,186	L16Q	probably damaging	Het
Sycp2	C	G	2: 178,381,855	S456T	probably benign	Het
Tk1	T	C	11: 117,817,095		probably benign	Het
Tlk2	C	A	11: 105,254,973	A335E	probably benign	Het
Tmtc1	T	C	6: 148,249,581	K659E	probably benign	Het
Tnk2	C	T	16: 32,680,590	P907L	probably benign	Het
Trim14	C	A	4: 46,522,043	K211N	probably damaging	Het
Trim15	A	C	17: 36,866,986	L39R	probably damaging	Het
Tspan15	T	A	10: 62,188,093	T269S	probably benign	Het
Ttc7	T	A	17: 87,361,864	D646E	probably benign	Het
Ttll6	A	T	11: 96,147,556	Q410L	probably benign	Het
Unc79	A	G	12: 103,061,407	Q419R	probably damaging	Het
Vcam1	A	T	3: 116,114,416	Y666N	possibly damaging	Het
Vmn1r10	A	T	6: 57,113,501	Y26F	probably damaging	Het
Vmn1r80	A	G	7: 12,193,848	N295S	probably benign	Het
Vmn2r114	A	T	17: 23,290,943	H854Q	probably benign	Het
Vmn2r2	A	T	3: 64,134,618	D225E	probably damaging	Het
Vmn2r4	A	T	3: 64,389,434	Y643*	probably null	Het
Vmn2r52	T	A	7: 10,159,466	Y582F	probably damaging	Het
Vmn2r60	G	T	7: 42,195,140	L642F	possibly damaging	Het
Zbtb20	T	C	16: 43,609,746	S207P	probably damaging	Het
Zic2	CCCACCACCACCATCACCACCACCACC	CCCACCATCACCACCACCACC	14: 122,476,364		probably benign	Het
Zkscan7	G	T	9: 122,888,893	E118*	probably null	Het

Other mutations in Nbeal2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Nbeal2	APN	9	110635869	missense	probably damaging	1.00
IGL00784:Nbeal2	APN	9	110629763	splice site	probably benign
IGL00826:Nbeal2	APN	9	110626903	missense	probably benign
IGL00885:Nbeal2	APN	9	110638661	missense	probably damaging	1.00
IGL01348:Nbeal2	APN	9	110629146	missense	probably damaging	0.99
IGL01511:Nbeal2	APN	9	110629234	missense	probably damaging	1.00
IGL01571:Nbeal2	APN	9	110632758	missense	possibly damaging	0.63
IGL01612:Nbeal2	APN	9	110644678	missense	probably damaging	1.00
IGL01924:Nbeal2	APN	9	110631414	missense	probably benign	0.23
IGL02056:Nbeal2	APN	9	110627324	missense	probably benign	0.17
IGL02481:Nbeal2	APN	9	110625995	nonsense	probably null
IGL02483:Nbeal2	APN	9	110625995	nonsense	probably null
IGL02502:Nbeal2	APN	9	110633768	missense	probably damaging	1.00
IGL02631:Nbeal2	APN	9	110630208	missense	probably damaging	0.99
IGL02637:Nbeal2	APN	9	110625977	missense	possibly damaging	0.62
IGL02727:Nbeal2	APN	9	110639285	splice site	probably benign
IGL02887:Nbeal2	APN	9	110628276	missense	probably damaging	1.00
IGL02896:Nbeal2	APN	9	110639292	critical splice donor site	probably null
IGL03110:Nbeal2	APN	9	110631433	missense	probably damaging	1.00
legion	UTSW	9	110629179	missense	probably damaging	1.00
litigious	UTSW	9	110628195	missense	probably damaging	1.00
mall	UTSW	9	110632886	missense	probably damaging	1.00
Mollusca	UTSW	9	110645438	intron	probably null
schleuter	UTSW	9	110628744	missense	possibly damaging	0.69
shellfish	UTSW	9	110628720	missense	probably damaging	1.00
F5770:Nbeal2	UTSW	9	110637937	missense	possibly damaging	0.65
R0032:Nbeal2	UTSW	9	110637868	splice site	probably benign
R0084:Nbeal2	UTSW	9	110643710	critical splice donor site	probably null
R0147:Nbeal2	UTSW	9	110642143	nonsense	probably null
R0294:Nbeal2	UTSW	9	110632859	missense	probably damaging	1.00
R0494:Nbeal2	UTSW	9	110627187	missense	probably damaging	1.00
R0550:Nbeal2	UTSW	9	110642158	missense	probably benign	0.01
R0630:Nbeal2	UTSW	9	110636034	splice site	probably benign
R0762:Nbeal2	UTSW	9	110643808	splice site	probably benign
R0862:Nbeal2	UTSW	9	110628195	missense	probably damaging	1.00
R0864:Nbeal2	UTSW	9	110628195	missense	probably damaging	1.00
R1225:Nbeal2	UTSW	9	110632886	missense	probably damaging	1.00
R1240:Nbeal2	UTSW	9	110627108	missense	probably damaging	0.98
R1450:Nbeal2	UTSW	9	110633672	splice site	probably benign
R1519:Nbeal2	UTSW	9	110636305	missense	probably damaging	1.00
R1655:Nbeal2	UTSW	9	110632872	missense	probably damaging	1.00
R1668:Nbeal2	UTSW	9	110638893	missense	probably damaging	1.00
R1705:Nbeal2	UTSW	9	110625196	missense	probably damaging	1.00
R1784:Nbeal2	UTSW	9	110630857	nonsense	probably null
R1834:Nbeal2	UTSW	9	110627129	missense	probably damaging	1.00
R1997:Nbeal2	UTSW	9	110632198	missense	probably damaging	1.00
R2013:Nbeal2	UTSW	9	110634071	missense	probably benign	0.09
R2014:Nbeal2	UTSW	9	110634071	missense	probably benign	0.09
R2055:Nbeal2	UTSW	9	110635307	missense	possibly damaging	0.92
R2086:Nbeal2	UTSW	9	110634071	missense	probably benign	0.09
R2113:Nbeal2	UTSW	9	110625406	missense	probably damaging	1.00
R2167:Nbeal2	UTSW	9	110638308	missense	probably damaging	1.00
R2201:Nbeal2	UTSW	9	110630250	missense	probably benign	0.16
R2309:Nbeal2	UTSW	9	110626570	missense	probably damaging	1.00
R2378:Nbeal2	UTSW	9	110630808	missense	probably damaging	0.99
R2945:Nbeal2	UTSW	9	110628068	missense	possibly damaging	0.82
R3052:Nbeal2	UTSW	9	110633085	missense	possibly damaging	0.93
R3076:Nbeal2	UTSW	9	110631700	missense	probably damaging	1.00
R3176:Nbeal2	UTSW	9	110636887	splice site	probably benign
R3974:Nbeal2	UTSW	9	110633846	missense	probably damaging	1.00
R4183:Nbeal2	UTSW	9	110636675	missense	probably benign
R4342:Nbeal2	UTSW	9	110631793	intron	probably benign
R4654:Nbeal2	UTSW	9	110632004	missense	probably damaging	1.00
R4707:Nbeal2	UTSW	9	110632055	missense	probably benign	0.10
R4822:Nbeal2	UTSW	9	110636315	missense	possibly damaging	0.82
R4854:Nbeal2	UTSW	9	110631396	missense	probably damaging	1.00
R4860:Nbeal2	UTSW	9	110635194	missense	probably benign	0.00
R4860:Nbeal2	UTSW	9	110635194	missense	probably benign	0.00
R4990:Nbeal2	UTSW	9	110634803	missense	probably benign	0.10
R4991:Nbeal2	UTSW	9	110638767	missense	probably damaging	1.00
R5021:Nbeal2	UTSW	9	110637463	missense	probably damaging	0.99
R5057:Nbeal2	UTSW	9	110631005	missense	probably damaging	1.00
R5092:Nbeal2	UTSW	9	110626728	splice site	probably null
R5161:Nbeal2	UTSW	9	110629868	missense	probably benign
R5202:Nbeal2	UTSW	9	110644666	missense	probably damaging	0.99
R5217:Nbeal2	UTSW	9	110632090	missense	possibly damaging	0.56
R5408:Nbeal2	UTSW	9	110637520	missense	possibly damaging	0.91
R5540:Nbeal2	UTSW	9	110631733	missense	probably damaging	1.00
R5866:Nbeal2	UTSW	9	110631492	missense	probably damaging	1.00
R5925:Nbeal2	UTSW	9	110629880	missense	probably benign	0.00
R6057:Nbeal2	UTSW	9	110641877	missense	possibly damaging	0.81
R6180:Nbeal2	UTSW	9	110625147	missense	probably damaging	1.00
R6191:Nbeal2	UTSW	9	110627990	critical splice donor site	probably null
R6232:Nbeal2	UTSW	9	110638734	missense	probably damaging	1.00
R6372:Nbeal2	UTSW	9	110628744	missense	possibly damaging	0.69
R6423:Nbeal2	UTSW	9	110625994	missense	probably damaging	1.00
R6543:Nbeal2	UTSW	9	110644458	missense	probably benign
R6648:Nbeal2	UTSW	9	110637642	missense	probably damaging	1.00
R6722:Nbeal2	UTSW	9	110632992	missense	probably damaging	1.00
R6738:Nbeal2	UTSW	9	110636905	missense	possibly damaging	0.93
R6916:Nbeal2	UTSW	9	110626108	missense	probably damaging	1.00
R6935:Nbeal2	UTSW	9	110639391	missense	probably damaging	1.00
R7022:Nbeal2	UTSW	9	110638618	missense	probably damaging	1.00
R7023:Nbeal2	UTSW	9	110638618	missense	probably damaging	1.00
R7050:Nbeal2	UTSW	9	110628720	missense	probably damaging	1.00
R7072:Nbeal2	UTSW	9	110626051	missense	probably benign	0.01
R7073:Nbeal2	UTSW	9	110626109	missense	probably damaging	0.99
R7099:Nbeal2	UTSW	9	110645438	intron	probably null
R7354:Nbeal2	UTSW	9	110629179	missense	probably damaging	1.00
R7394:Nbeal2	UTSW	9	110630189	critical splice donor site	probably null
R7397:Nbeal2	UTSW	9	110628032	missense	possibly damaging	0.78
R7552:Nbeal2	UTSW	9	110653917	missense	probably benign	0.16
R7619:Nbeal2	UTSW	9	110625818	missense	probably benign	0.19
R7821:Nbeal2	UTSW	9	110630252	missense	probably damaging	1.00
V7583:Nbeal2	UTSW	9	110637937	missense	possibly damaging	0.65
X0017:Nbeal2	UTSW	9	110644278	missense	probably benign	0.02
X0065:Nbeal2	UTSW	9	110644413	splice site	probably benign
Z1088:Nbeal2	UTSW	9	110632372	missense	possibly damaging	0.51

Predicted Primers

PCR Primer
(F):5'- AAACCTGCCTGGCATACCTCACTG -3'
(R):5'- TGCCTGGCTGTGTCTACAATCG -3'

Sequencing Primer
(F):5'- CATTGACCAGGTTCTGACTGAAG -3'
(R):5'- GCTGTGTCTACAATCGTCAGAG -3'

Posted On

2013-04-16