Incidental Mutation 'R2510:Olfr1286'
ID251905
Institutional Source Beutler Lab
Gene Symbol Olfr1286
Ensembl Gene ENSMUSG00000096703
Gene Nameolfactory receptor 1286
SynonymsMOR248-21, GA_x6K02T2Q125-72472405-72471488
MMRRC Submission 040416-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R2510 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111417842-111423115 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 111420451 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 167 (P167S)
Ref Sequence ENSEMBL: ENSMUSP00000148932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099617] [ENSMUST00000184954] [ENSMUST00000213210]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099617
AA Change: P167S

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097212
Gene: ENSMUSG00000096703
AA Change: P167S

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 3.4e-47 PFAM
Pfam:7TM_GPCR_Srsx 35 301 3.4e-7 PFAM
Pfam:7tm_1 41 287 1.8e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000184954
AA Change: P167S

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000144852
Gene: ENSMUSG00000096703
AA Change: P167S

DomainStartEndE-ValueType
Pfam:7tm_4 1 264 7.6e-38 PFAM
Pfam:7tm_1 5 251 7.2e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213210
AA Change: P167S

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
Meta Mutation Damage Score 0.2375 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,625,300 M506V probably benign Het
4930571K23Rik C A 7: 125,369,139 noncoding transcript Het
Adra1d C A 2: 131,562,135 E12* probably null Het
Ago4 A T 4: 126,517,071 D208E probably damaging Het
Agrn A T 4: 156,166,424 probably null Het
Atxn2 C T 5: 121,781,393 S388L probably damaging Het
Bbox1 A T 2: 110,305,631 M1K probably null Het
Btaf1 G A 19: 37,002,445 R1538H probably benign Het
Car11 G A 7: 45,701,359 G93E probably damaging Het
Col18a1 A G 10: 77,096,268 L329P unknown Het
Copb2 T A 9: 98,571,648 probably benign Het
Dnah2 G T 11: 69,524,206 S234* probably null Het
Dnah9 T C 11: 66,005,169 Y2460C probably damaging Het
Dnaic2 G C 11: 114,757,167 probably benign Het
Dst C A 1: 34,212,286 T1814K probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fancm A T 12: 65,113,770 probably benign Het
Fsip2 T C 2: 82,986,438 S4172P probably benign Het
G530012D18Rik T G 1: 85,577,204 probably benign Het
Gca T G 2: 62,689,974 S159R probably damaging Het
Gja8 T G 3: 96,919,717 T210P probably damaging Het
Gm10639 T A 9: 78,294,807 M1K probably null Het
Gm13103 G A 4: 143,851,991 V274I probably benign Het
Gm5117 T A 8: 31,738,355 noncoding transcript Het
Gm5900 T A 7: 104,950,364 noncoding transcript Het
Gpi1 A G 7: 34,205,923 S359P probably damaging Het
Grm5 A G 7: 88,036,091 E472G probably benign Het
Hoxd12 G A 2: 74,675,471 A129T possibly damaging Het
Ifnlr1 G T 4: 135,705,248 D332Y probably damaging Het
Ift140 T C 17: 25,036,308 I466T probably benign Het
Kansl2 A G 15: 98,528,861 probably null Het
Kat2a T C 11: 100,712,142 Q88R probably benign Het
Kcnh7 T C 2: 62,721,917 D910G probably benign Het
Klk1b1 T C 7: 43,969,379 V60A probably damaging Het
Krt7 A C 15: 101,412,657 I62L probably benign Het
Llgl1 A G 11: 60,710,036 K653E probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mafb T G 2: 160,366,576 E34A probably damaging Het
Meiob T C 17: 24,816,597 probably benign Het
Mllt10 C A 2: 18,065,124 D30E possibly damaging Het
Mprip T A 11: 59,749,508 probably benign Het
Muc5b A T 7: 141,859,061 N1915Y unknown Het
Mycbp2 C T 14: 103,155,255 R3290Q probably damaging Het
Obscn G A 11: 59,042,314 probably benign Het
Olfm3 T A 3: 115,122,310 V277D probably damaging Het
Olfr1271 C T 2: 90,265,606 V275I probably damaging Het
Olfr668 G A 7: 104,925,687 H26Y probably benign Het
Olfr960 T A 9: 39,623,431 F101I probably damaging Het
Omp A T 7: 98,145,345 M25K possibly damaging Het
Otoa C T 7: 121,160,472 T1099I probably benign Het
Pcdh15 T G 10: 74,631,499 S1715A probably benign Het
Pcnx4 T C 12: 72,566,972 W564R probably damaging Het
Pde12 T C 14: 26,665,526 *609W probably null Het
Pitpnm2 T C 5: 124,136,326 E240G probably damaging Het
Plppr4 G T 3: 117,331,706 N161K probably damaging Het
Ppp1r37 T C 7: 19,532,432 K470E possibly damaging Het
Ptprd C A 4: 76,086,011 probably null Het
Rgs9 T C 11: 109,268,972 Y178C probably benign Het
Rims2 T G 15: 39,585,652 S1217R probably damaging Het
Rorc C T 3: 94,389,120 T208I probably benign Het
Ryr3 C T 2: 112,675,904 E3458K probably benign Het
Scn5a A T 9: 119,533,685 V623E probably benign Het
Slc28a2 C T 2: 122,451,016 Q229* probably null Het
Slc35f3 C T 8: 126,298,706 probably benign Het
Spg11 T G 2: 122,075,310 I1285L probably benign Het
Sstr2 A T 11: 113,624,923 I223F probably damaging Het
Susd1 A T 4: 59,349,855 V527E possibly damaging Het
Tas1r2 A G 4: 139,659,851 N207S probably damaging Het
Tmem57 A G 4: 134,804,388 S657P probably damaging Het
Trappc10 A G 10: 78,211,523 S380P possibly damaging Het
Ttn T C 2: 76,740,992 D26519G probably damaging Het
Vmn1r215 A G 13: 23,076,173 I128V probably benign Het
Vmn1r37 T C 6: 66,731,951 L150P probably damaging Het
Vmn2r52 G T 7: 10,170,868 A348E probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Wdyhv1 C A 15: 58,153,624 A145D probably damaging Het
Ypel5 T C 17: 72,846,391 L30P probably damaging Het
Zfp985 A G 4: 147,582,986 T104A possibly damaging Het
Other mutations in Olfr1286
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01596:Olfr1286 APN 2 111420892 missense probably benign 0.04
IGL01953:Olfr1286 APN 2 111420312 missense probably benign 0.22
IGL02251:Olfr1286 APN 2 111420312 missense probably damaging 0.99
IGL02514:Olfr1286 APN 2 111420772 missense probably damaging 1.00
IGL02868:Olfr1286 APN 2 111420493 missense possibly damaging 0.55
PIT4403001:Olfr1286 UTSW 2 111420820 missense probably benign 0.00
R0630:Olfr1286 UTSW 2 111420846 missense probably damaging 1.00
R1442:Olfr1286 UTSW 2 111420093 missense probably damaging 1.00
R1712:Olfr1286 UTSW 2 111420658 missense probably benign 0.22
R4399:Olfr1286 UTSW 2 111420799 missense probably benign 0.00
R4984:Olfr1286 UTSW 2 111420847 missense probably damaging 1.00
R5186:Olfr1286 UTSW 2 111420774 missense probably damaging 1.00
R6044:Olfr1286 UTSW 2 111420078 missense probably damaging 1.00
R6107:Olfr1286 UTSW 2 111420655 missense probably benign 0.01
R6372:Olfr1286 UTSW 2 111420802 missense probably benign 0.12
R7230:Olfr1286 UTSW 2 111420916 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCTTTAGAGCGATGTTGAACAG -3'
(R):5'- TGAGCCAGATCGTCTGTGTG -3'

Sequencing Primer
(F):5'- GCGATGTTGAACAGTTAATAGAATG -3'
(R):5'- AGATCGTCTGTGTGCACTTC -3'
Posted On2014-12-04