Incidental Mutation 'R0311:Ythdc1'
ID25191
Institutional Source Beutler Lab
Gene Symbol Ythdc1
Ensembl Gene ENSMUSG00000035851
Gene NameYTH domain containing 1
SynonymsA730098D12Rik
MMRRC Submission 038521-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R0311 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location86804221-86836659 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86835705 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 670 (D670N)
Ref Sequence ENSEMBL: ENSMUSP00000039133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038384] [ENSMUST00000119339] [ENSMUST00000120498] [ENSMUST00000156363]
Predicted Effect probably damaging
Transcript: ENSMUST00000038384
AA Change: D670N

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039133
Gene: ENSMUSG00000035851
AA Change: D670N

DomainStartEndE-ValueType
SCOP:d1qbkb_ 225 249 6e-3 SMART
low complexity region 269 280 N/A INTRINSIC
low complexity region 316 330 N/A INTRINSIC
Pfam:YTH 356 494 5e-42 PFAM
low complexity region 516 540 N/A INTRINSIC
low complexity region 609 622 N/A INTRINSIC
low complexity region 625 645 N/A INTRINSIC
low complexity region 682 736 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000119339
AA Change: D644N
SMART Domains Protein: ENSMUSP00000113000
Gene: ENSMUSG00000035851
AA Change: D644N

DomainStartEndE-ValueType
SCOP:d1qbkb_ 225 249 6e-3 SMART
low complexity region 269 280 N/A INTRINSIC
Pfam:YTH 337 478 4.4e-44 PFAM
low complexity region 498 522 N/A INTRINSIC
low complexity region 583 596 N/A INTRINSIC
low complexity region 599 619 N/A INTRINSIC
low complexity region 656 710 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000120498
AA Change: D662N
SMART Domains Protein: ENSMUSP00000113951
Gene: ENSMUSG00000035851
AA Change: D662N

DomainStartEndE-ValueType
SCOP:d1qbkb_ 225 249 6e-3 SMART
low complexity region 269 280 N/A INTRINSIC
low complexity region 316 330 N/A INTRINSIC
Pfam:YTH 355 496 4.6e-44 PFAM
low complexity region 516 540 N/A INTRINSIC
low complexity region 601 614 N/A INTRINSIC
low complexity region 617 637 N/A INTRINSIC
low complexity region 674 728 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151489
Predicted Effect probably benign
Transcript: ENSMUST00000156363
SMART Domains Protein: ENSMUSP00000122491
Gene: ENSMUSG00000035851

DomainStartEndE-ValueType
SCOP:d1qbkb_ 237 261 8e-3 SMART
low complexity region 281 292 N/A INTRINSIC
Pfam:YTH 350 488 3e-42 PFAM
low complexity region 510 525 N/A INTRINSIC
Meta Mutation Damage Score 0.1807 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.6%
  • 20x: 91.6%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A C 7: 120,402,904 M1547L probably damaging Het
Abcb4 A G 5: 8,934,243 K658E probably benign Het
Abr A G 11: 76,509,127 S15P possibly damaging Het
Adgrb2 G C 4: 130,017,129 A1168P probably damaging Het
Adgre4 A T 17: 55,802,010 E339V probably benign Het
Asprv1 T C 6: 86,628,840 W223R probably damaging Het
Ccdc89 A G 7: 90,426,693 E37G probably damaging Het
Cd48 C A 1: 171,699,580 Y191* probably null Het
Chd4 T C 6: 125,101,665 I257T probably benign Het
Clca4b T C 3: 144,932,496 M2V probably benign Het
Dnah11 A T 12: 118,127,133 D1025E probably benign Het
Erich5 A G 15: 34,472,939 *363W probably null Het
Etl4 A G 2: 20,807,129 D1341G probably damaging Het
Fbxw11 A G 11: 32,722,083 T184A probably benign Het
Fktn A G 4: 53,744,620 Q300R probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gdpd3 G A 7: 126,767,189 R66Q possibly damaging Het
Hexb A G 13: 97,183,819 probably benign Het
Kdm4b A G 17: 56,386,200 R346G probably benign Het
Mbtd1 T A 11: 93,921,357 probably null Het
Med23 T A 10: 24,897,358 C653S possibly damaging Het
Nwd2 A T 5: 63,804,998 I642L probably damaging Het
Olfr1444 A G 19: 12,861,869 I31M probably benign Het
Olfr1448 T A 19: 12,920,096 Y71F possibly damaging Het
Olfr912 T C 9: 38,539,297 V134A probably benign Het
Pbld2 T C 10: 63,054,507 probably null Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Plpp2 C T 10: 79,527,580 R77K probably damaging Het
Pym1 G T 10: 128,765,984 R168L possibly damaging Het
Rbm4 T C 19: 4,787,556 Y300C probably damaging Het
Rnf207 A G 4: 152,315,779 C175R probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Speg T C 1: 75,430,937 V3196A probably damaging Het
Syne1 T A 10: 5,348,943 I1048L possibly damaging Het
Th T C 7: 142,896,041 E41G probably damaging Het
Tmx4 T A 2: 134,598,526 *336L probably null Het
Tnfrsf18 T C 4: 156,026,415 V10A possibly damaging Het
Tnxb A T 17: 34,716,984 I2670F probably damaging Het
Tpx2 T C 2: 152,890,492 V562A probably damaging Het
Vmn2r73 A G 7: 85,871,789 S324P probably benign Het
Vps18 T C 2: 119,297,365 Y890H probably benign Het
Other mutations in Ythdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00676:Ythdc1 APN 5 86831811 missense probably damaging 1.00
IGL02222:Ythdc1 APN 5 86828043 missense possibly damaging 0.72
R0091:Ythdc1 UTSW 5 86820701 intron probably benign
R0349:Ythdc1 UTSW 5 86835720 missense probably damaging 1.00
R0630:Ythdc1 UTSW 5 86809348 splice site probably benign
R1662:Ythdc1 UTSW 5 86828122 critical splice donor site probably null
R1907:Ythdc1 UTSW 5 86830630 missense probably damaging 1.00
R2100:Ythdc1 UTSW 5 86816685 missense possibly damaging 0.62
R2911:Ythdc1 UTSW 5 86816559 missense possibly damaging 0.95
R3692:Ythdc1 UTSW 5 86822667 missense probably damaging 0.98
R4042:Ythdc1 UTSW 5 86816524 missense probably benign 0.03
R4398:Ythdc1 UTSW 5 86815654 missense possibly damaging 0.95
R4398:Ythdc1 UTSW 5 86835820 utr 3 prime probably benign
R4608:Ythdc1 UTSW 5 86822808 missense probably damaging 0.97
R4806:Ythdc1 UTSW 5 86822845 missense probably damaging 0.99
R5291:Ythdc1 UTSW 5 86835688 missense probably damaging 1.00
R5761:Ythdc1 UTSW 5 86835951 utr 3 prime probably benign
R6180:Ythdc1 UTSW 5 86828094 missense possibly damaging 0.91
R6249:Ythdc1 UTSW 5 86831956 missense possibly damaging 0.94
R6560:Ythdc1 UTSW 5 86816608 missense probably benign 0.06
R7145:Ythdc1 UTSW 5 86816608 missense probably benign 0.06
R8072:Ythdc1 UTSW 5 86821274 nonsense probably null
R8225:Ythdc1 UTSW 5 86816937 missense possibly damaging 0.91
R8225:Ythdc1 UTSW 5 86816938 missense possibly damaging 0.73
R8246:Ythdc1 UTSW 5 86817322 missense possibly damaging 0.94
R8284:Ythdc1 UTSW 5 86816466 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- CATGAAAGGGTGTGTTGCACAAAGG -3'
(R):5'- AAAAGAGTCAACCCAACTGTCAACTGT -3'

Sequencing Primer
(F):5'- GAAATTACAGGAATACATGGTGCTC -3'
(R):5'- TCCCctcggtctctgtcc -3'
Posted On2013-04-16