Mutagenetix > Incidental Mutations

Incidental Mutation 'R2510:Spg11'

251910

Institutional Source

Beutler Lab

Gene Symbol

Spg11

Ensembl Gene

ENSMUSG00000033396

Gene Name

SPG11, spatacsin vesicle trafficking associated

Synonyms

C530005A01Rik, 6030465E24Rik

MMRRC Submission

040416-MU

Accession Numbers

Genbank: NM_145531

Is this an essential gene?

Probably non essential (E-score: 0.202) question?

Stock #

R2510 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

122053520-122118386 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 122075310 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 1285 (I1285L)

Ref Sequence

ENSEMBL: ENSMUSP00000037543 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036450]

Predicted Effect

probably benign
Transcript: ENSMUST00000036450
AA Change: I1285L

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000037543
Gene: ENSMUSG00000033396
AA Change: I1285L

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
low complexity region	254	276	N/A	INTRINSIC
low complexity region	945	958	N/A	INTRINSIC
low complexity region	1250	1264	N/A	INTRINSIC
low complexity region	1305	1313	N/A	INTRINSIC
low complexity region	1673	1684	N/A	INTRINSIC
low complexity region	1772	1784	N/A	INTRINSIC
Pfam:Spatacsin_C	2082	2374	1.1e-105	PFAM

Meta Mutation Damage Score

0.0606

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 94.9%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a potential transmembrane protein that is phosphorylated upon DNA damage. Defects in this gene are a cause of spastic paraplegia type 11 (SPG11). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a knock-out allele develop a progressive spastic and ataxic gait disorder and show loss of cortical motoneurons and Purkinje cells, a reduced number of lysosomes available for fusion with autophagosomes in degenerating neurons, and accumulation of autolysosome-derived material. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	T	C	1: 37,625,300	M506V	probably benign	Het
4930571K23Rik	C	A	7: 125,369,139		noncoding transcript	Het
Adra1d	C	A	2: 131,562,135	E12*	probably null	Het
Ago4	A	T	4: 126,517,071	D208E	probably damaging	Het
Agrn	A	T	4: 156,166,424		probably null	Het
Atxn2	C	T	5: 121,781,393	S388L	probably damaging	Het
Bbox1	A	T	2: 110,305,631	M1K	probably null	Het
Btaf1	G	A	19: 37,002,445	R1538H	probably benign	Het
Car11	G	A	7: 45,701,359	G93E	probably damaging	Het
Col18a1	A	G	10: 77,096,268	L329P	unknown	Het
Copb2	T	A	9: 98,571,648		probably benign	Het
Dnah2	G	T	11: 69,524,206	S234*	probably null	Het
Dnah9	T	C	11: 66,005,169	Y2460C	probably damaging	Het
Dnaic2	G	C	11: 114,757,167		probably benign	Het
Dst	C	A	1: 34,212,286	T1814K	probably benign	Het
F11	A	G	8: 45,248,638	S353P	probably damaging	Het
Fancm	A	T	12: 65,113,770		probably benign	Het
Fsip2	T	C	2: 82,986,438	S4172P	probably benign	Het
G530012D18Rik	T	G	1: 85,577,204		probably benign	Het
Gca	T	G	2: 62,689,974	S159R	probably damaging	Het
Gja8	T	G	3: 96,919,717	T210P	probably damaging	Het
Gm10639	T	A	9: 78,294,807	M1K	probably null	Het
Gm13103	G	A	4: 143,851,991	V274I	probably benign	Het
Gm5117	T	A	8: 31,738,355		noncoding transcript	Het
Gm5900	T	A	7: 104,950,364		noncoding transcript	Het
Gpi1	A	G	7: 34,205,923	S359P	probably damaging	Het
Grm5	A	G	7: 88,036,091	E472G	probably benign	Het
Hoxd12	G	A	2: 74,675,471	A129T	possibly damaging	Het
Ifnlr1	G	T	4: 135,705,248	D332Y	probably damaging	Het
Ift140	T	C	17: 25,036,308	I466T	probably benign	Het
Kansl2	A	G	15: 98,528,861		probably null	Het
Kat2a	T	C	11: 100,712,142	Q88R	probably benign	Het
Kcnh7	T	C	2: 62,721,917	D910G	probably benign	Het
Klk1b1	T	C	7: 43,969,379	V60A	probably damaging	Het
Krt7	A	C	15: 101,412,657	I62L	probably benign	Het
Llgl1	A	G	11: 60,710,036	K653E	probably damaging	Het
Lmo2	T	C	2: 103,981,062	Y147H	probably damaging	Het
Mafb	T	G	2: 160,366,576	E34A	probably damaging	Het
Meiob	T	C	17: 24,816,597		probably benign	Het
Mllt10	C	A	2: 18,065,124	D30E	possibly damaging	Het
Mprip	T	A	11: 59,749,508		probably benign	Het
Muc5b	A	T	7: 141,859,061	N1915Y	unknown	Het
Mycbp2	C	T	14: 103,155,255	R3290Q	probably damaging	Het
Obscn	G	A	11: 59,042,314		probably benign	Het
Olfm3	T	A	3: 115,122,310	V277D	probably damaging	Het
Olfr1271	C	T	2: 90,265,606	V275I	probably damaging	Het
Olfr1286	G	A	2: 111,420,451	P167S	possibly damaging	Het
Olfr668	G	A	7: 104,925,687	H26Y	probably benign	Het
Olfr960	T	A	9: 39,623,431	F101I	probably damaging	Het
Omp	A	T	7: 98,145,345	M25K	possibly damaging	Het
Otoa	C	T	7: 121,160,472	T1099I	probably benign	Het
Pcdh15	T	G	10: 74,631,499	S1715A	probably benign	Het
Pcnx4	T	C	12: 72,566,972	W564R	probably damaging	Het
Pde12	T	C	14: 26,665,526	*609W	probably null	Het
Pitpnm2	T	C	5: 124,136,326	E240G	probably damaging	Het
Plppr4	G	T	3: 117,331,706	N161K	probably damaging	Het
Ppp1r37	T	C	7: 19,532,432	K470E	possibly damaging	Het
Ptprd	C	A	4: 76,086,011		probably null	Het
Rgs9	T	C	11: 109,268,972	Y178C	probably benign	Het
Rims2	T	G	15: 39,585,652	S1217R	probably damaging	Het
Rorc	C	T	3: 94,389,120	T208I	probably benign	Het
Ryr3	C	T	2: 112,675,904	E3458K	probably benign	Het
Scn5a	A	T	9: 119,533,685	V623E	probably benign	Het
Slc28a2	C	T	2: 122,451,016	Q229*	probably null	Het
Slc35f3	C	T	8: 126,298,706		probably benign	Het
Sstr2	A	T	11: 113,624,923	I223F	probably damaging	Het
Susd1	A	T	4: 59,349,855	V527E	possibly damaging	Het
Tas1r2	A	G	4: 139,659,851	N207S	probably damaging	Het
Tmem57	A	G	4: 134,804,388	S657P	probably damaging	Het
Trappc10	A	G	10: 78,211,523	S380P	possibly damaging	Het
Ttn	T	C	2: 76,740,992	D26519G	probably damaging	Het
Vmn1r215	A	G	13: 23,076,173	I128V	probably benign	Het
Vmn1r37	T	C	6: 66,731,951	L150P	probably damaging	Het
Vmn2r52	G	T	7: 10,170,868	A348E	probably benign	Het
Vmn2r-ps159	G	T	4: 156,334,397		noncoding transcript	Het
Wdyhv1	C	A	15: 58,153,624	A145D	probably damaging	Het
Ypel5	T	C	17: 72,846,391	L30P	probably damaging	Het
Zfp985	A	G	4: 147,582,986	T104A	possibly damaging	Het

Other mutations in Spg11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00426:Spg11	APN	2	122065560	missense	probably damaging	0.96
IGL00495:Spg11	APN	2	122094456	critical splice donor site	probably null
IGL00757:Spg11	APN	2	122070959	missense	probably benign	0.05
IGL01304:Spg11	APN	2	122072290	missense	probably damaging	1.00
IGL01355:Spg11	APN	2	122113156	missense	probably benign
IGL01626:Spg11	APN	2	122060971	missense	probably damaging	0.98
IGL01739:Spg11	APN	2	122114671	missense	probably damaging	1.00
IGL01835:Spg11	APN	2	122088224	missense	probably benign	0.36
IGL02129:Spg11	APN	2	122095686	missense	probably damaging	0.99
IGL02178:Spg11	APN	2	122097302	missense	probably damaging	1.00
IGL02199:Spg11	APN	2	122059553	missense	probably damaging	1.00
IGL02212:Spg11	APN	2	122108157	missense	probably benign	0.31
IGL02605:Spg11	APN	2	122092260	missense	probably benign	0.00
IGL02635:Spg11	APN	2	122113068	missense	possibly damaging	0.52
IGL02743:Spg11	APN	2	122059507	missense	probably damaging	0.97
IGL02822:Spg11	APN	2	122074534	missense	probably damaging	0.99
IGL02992:Spg11	APN	2	122058398	missense	probably damaging	1.00
IGL03010:Spg11	APN	2	122088320	missense	probably damaging	0.96
3-1:Spg11	UTSW	2	122086890	missense	probably damaging	0.98
PIT4354001:Spg11	UTSW	2	122088185	missense	probably damaging	0.98
R0131:Spg11	UTSW	2	122070968	missense	probably damaging	1.00
R0206:Spg11	UTSW	2	122055696	critical splice donor site	probably null
R0208:Spg11	UTSW	2	122055696	critical splice donor site	probably null
R0302:Spg11	UTSW	2	122092187	missense	possibly damaging	0.90
R0347:Spg11	UTSW	2	122097369	missense	probably damaging	0.99
R0357:Spg11	UTSW	2	122066232	splice site	probably benign
R0372:Spg11	UTSW	2	122059447	frame shift	probably null
R0715:Spg11	UTSW	2	122084983	missense	probably benign	0.03
R0927:Spg11	UTSW	2	122094487	missense	probably damaging	0.99
R1163:Spg11	UTSW	2	122070941	missense	probably damaging	1.00
R1534:Spg11	UTSW	2	122092325	missense	probably damaging	1.00
R1555:Spg11	UTSW	2	122097377	missense	probably damaging	0.99
R1569:Spg11	UTSW	2	122101706	missense	probably damaging	0.99
R1840:Spg11	UTSW	2	122101756	missense	probably damaging	1.00
R1929:Spg11	UTSW	2	122060207	missense	probably damaging	1.00
R2265:Spg11	UTSW	2	122108307	missense	possibly damaging	0.48
R2303:Spg11	UTSW	2	122068837	missense	probably damaging	0.99
R2760:Spg11	UTSW	2	122097359	missense	probably damaging	0.99
R2918:Spg11	UTSW	2	122075301	missense	probably damaging	0.99
R3195:Spg11	UTSW	2	122083398	critical splice donor site	probably null
R3423:Spg11	UTSW	2	122071053	missense	probably benign	0.00
R4353:Spg11	UTSW	2	122113194	missense	possibly damaging	0.92
R4407:Spg11	UTSW	2	122075332	missense	probably benign	0.00
R4644:Spg11	UTSW	2	122061029	missense	probably benign	0.03
R4663:Spg11	UTSW	2	122098099	critical splice donor site	probably null
R4684:Spg11	UTSW	2	122065076	missense	probably damaging	1.00
R4771:Spg11	UTSW	2	122065482	nonsense	probably null
R4810:Spg11	UTSW	2	122059796	missense	probably damaging	1.00
R4829:Spg11	UTSW	2	122108455	missense	probably benign	0.44
R5089:Spg11	UTSW	2	122114717	nonsense	probably null
R5362:Spg11	UTSW	2	122061000	missense	probably damaging	0.99
R5684:Spg11	UTSW	2	122093503	missense	probably damaging	1.00
R5899:Spg11	UTSW	2	122098199	missense	possibly damaging	0.67
R5923:Spg11	UTSW	2	122093478	missense	probably damaging	0.98
R6052:Spg11	UTSW	2	122097356	missense	probably damaging	0.99
R6111:Spg11	UTSW	2	122093482	missense	probably damaging	0.98
R6174:Spg11	UTSW	2	122086805	splice site	probably null
R6226:Spg11	UTSW	2	122088262	missense	possibly damaging	0.69
R6336:Spg11	UTSW	2	122112959	splice site	probably null
R6480:Spg11	UTSW	2	122092305	missense	probably benign	0.03
R6494:Spg11	UTSW	2	122113225	missense	probably damaging	0.98
R6582:Spg11	UTSW	2	122092292	missense	probably damaging	0.99
R6714:Spg11	UTSW	2	122095731	missense	probably damaging	0.99
R6791:Spg11	UTSW	2	122093443	missense	probably damaging	0.99
R6836:Spg11	UTSW	2	122059535	missense	probably damaging	1.00
R6928:Spg11	UTSW	2	122069904	missense	probably benign	0.37
R7179:Spg11	UTSW	2	122101789	splice site	probably null
R7229:Spg11	UTSW	2	122108104	missense	probably damaging	0.98
R7337:Spg11	UTSW	2	122084993	missense	probably benign	0.09
R7338:Spg11	UTSW	2	122055377	missense	probably damaging	1.00
R7351:Spg11	UTSW	2	122069931	missense	possibly damaging	0.95
R7378:Spg11	UTSW	2	122058429	missense	probably damaging	1.00
R7448:Spg11	UTSW	2	122093545	critical splice acceptor site	probably null
R7505:Spg11	UTSW	2	122075351	nonsense	probably null
R7665:Spg11	UTSW	2	122066267	missense	probably damaging	0.99
R7685:Spg11	UTSW	2	122068880	missense	probably damaging	0.99
R7779:Spg11	UTSW	2	122070939	missense	probably damaging	1.00
R7947:Spg11	UTSW	2	122092322	missense	probably damaging	1.00
R7958:Spg11	UTSW	2	122092945	splice site	probably null
R8024:Spg11	UTSW	2	122097321	missense	possibly damaging	0.67
R8033:Spg11	UTSW	2	122086951	missense	probably damaging	1.00
R8069:Spg11	UTSW	2	122113156	missense	probably benign
R8121:Spg11	UTSW	2	122069867	critical splice donor site	probably null
R8252:Spg11	UTSW	2	122088339	splice site	probably benign
R8358:Spg11	UTSW	2	122080258	missense	possibly damaging	0.69
R8362:Spg11	UTSW	2	122118361	missense	unknown
R8385:Spg11	UTSW	2	122097321	missense	probably benign	0.22
R8406:Spg11	UTSW	2	122093442	missense	probably damaging	0.99
R8480:Spg11	UTSW	2	122113079	missense	probably damaging	1.00
Z1177:Spg11	UTSW	2	122072985	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AAATTAATGAGGCTCAGGGTCATTC -3'
(R):5'- TTATTTTCTAGGATCCAGCAAGTAGGC -3'

Sequencing Primer
(F):5'- TGAGGCTCAGGGTCATTCAAACC -3'
(R):5'- GCAAGGAGGCCTATACCTTAG -3'

Posted On

2014-12-04