Incidental Mutation 'R2849:Celf2'
ID251912
Institutional Source Beutler Lab
Gene Symbol Celf2
Ensembl Gene ENSMUSG00000002107
Gene NameCUGBP, Elav-like family member 2
SynonymsNapor-2, ETR-3, B230345P09Rik, Cugbp2
MMRRC Submission 040442-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.632) question?
Stock #R2849 (G1)
Quality Score201
Status Not validated
Chromosome2
Chromosomal Location6539694-7509563 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6604125 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 282 (R282G)
Ref Sequence ENSEMBL: ENSMUSP00000138974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002176] [ENSMUST00000100429] [ENSMUST00000114924] [ENSMUST00000114927] [ENSMUST00000114934] [ENSMUST00000142941] [ENSMUST00000150624] [ENSMUST00000170438] [ENSMUST00000182404] [ENSMUST00000182706] [ENSMUST00000182851] [ENSMUST00000182879] [ENSMUST00000183091] [ENSMUST00000183209] [ENSMUST00000183984]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002176
AA Change: R195G

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000002176
Gene: ENSMUSG00000002107
AA Change: R195G

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
low complexity region 326 355 N/A INTRINSIC
low complexity region 379 392 N/A INTRINSIC
RRM 400 473 3.2e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100429
AA Change: R195G

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097996
Gene: ENSMUSG00000002107
AA Change: R195G

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
low complexity region 341 362 N/A INTRINSIC
low complexity region 385 398 N/A INTRINSIC
RRM 406 479 3.2e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114924
AA Change: R237G

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110574
Gene: ENSMUSG00000002107
AA Change: R237G

DomainStartEndE-ValueType
RRM 59 137 1.29e-17 SMART
RRM 151 226 4.22e-22 SMART
low complexity region 236 265 N/A INTRINSIC
low complexity region 294 321 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
low complexity region 368 397 N/A INTRINSIC
low complexity region 421 434 N/A INTRINSIC
RRM 442 515 3.2e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114927
AA Change: R195G

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110577
Gene: ENSMUSG00000002107
AA Change: R195G

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
low complexity region 341 359 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
RRM 404 477 3.2e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114934
AA Change: R237G

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110584
Gene: ENSMUSG00000002107
AA Change: R237G

DomainStartEndE-ValueType
RRM 59 137 1.29e-17 SMART
RRM 151 226 4.22e-22 SMART
low complexity region 236 265 N/A INTRINSIC
low complexity region 294 321 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
low complexity region 368 397 N/A INTRINSIC
low complexity region 421 434 N/A INTRINSIC
RRM 442 515 3.2e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138347
SMART Domains Protein: ENSMUSP00000114914
Gene: ENSMUSG00000002107

DomainStartEndE-ValueType
RRM 24 102 1.29e-17 SMART
RRM 116 184 1.64e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000142941
AA Change: R195G

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120459
Gene: ENSMUSG00000002107
AA Change: R195G

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
low complexity region 341 362 N/A INTRINSIC
low complexity region 385 398 N/A INTRINSIC
RRM 406 479 3.2e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148321
Predicted Effect possibly damaging
Transcript: ENSMUST00000150624
AA Change: R195G

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138297
Gene: ENSMUSG00000002107
AA Change: R195G

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
low complexity region 341 359 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
RRM 404 477 3.2e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000170438
AA Change: R237G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130829
Gene: ENSMUSG00000002107
AA Change: R237G

DomainStartEndE-ValueType
RRM 59 137 1.29e-17 SMART
RRM 151 226 4.22e-22 SMART
low complexity region 236 265 N/A INTRINSIC
low complexity region 294 321 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
RRM 384 467 4.92e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182404
AA Change: R108G

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138769
Gene: ENSMUSG00000002107
AA Change: R108G

DomainStartEndE-ValueType
RRM 22 97 4.22e-22 SMART
low complexity region 107 136 N/A INTRINSIC
low complexity region 165 192 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 254 272 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182706
AA Change: R231G

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138764
Gene: ENSMUSG00000002107
AA Change: R231G

DomainStartEndE-ValueType
RRM 53 131 1.29e-17 SMART
RRM 145 220 4.22e-22 SMART
low complexity region 230 259 N/A INTRINSIC
low complexity region 288 315 N/A INTRINSIC
low complexity region 317 329 N/A INTRINSIC
low complexity region 362 391 N/A INTRINSIC
low complexity region 415 428 N/A INTRINSIC
RRM 436 509 3.2e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182851
AA Change: R219G

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138363
Gene: ENSMUSG00000002107
AA Change: R219G

DomainStartEndE-ValueType
RRM 41 119 1.29e-17 SMART
RRM 133 208 4.22e-22 SMART
low complexity region 218 247 N/A INTRINSIC
low complexity region 276 303 N/A INTRINSIC
low complexity region 305 317 N/A INTRINSIC
low complexity region 350 379 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
RRM 424 497 3.2e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182879
AA Change: R195G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138359
Gene: ENSMUSG00000002107
AA Change: R195G

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
RRM 346 429 4.92e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000183091
AA Change: R219G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138795
Gene: ENSMUSG00000002107
AA Change: R219G

DomainStartEndE-ValueType
RRM 41 119 1.29e-17 SMART
RRM 133 208 4.22e-22 SMART
low complexity region 218 247 N/A INTRINSIC
low complexity region 276 303 N/A INTRINSIC
low complexity region 305 317 N/A INTRINSIC
RRM 366 449 4.92e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000183209
AA Change: R231G

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138355
Gene: ENSMUSG00000002107
AA Change: R231G

DomainStartEndE-ValueType
RRM 53 131 1.29e-17 SMART
RRM 145 220 4.22e-22 SMART
low complexity region 230 259 N/A INTRINSIC
low complexity region 288 315 N/A INTRINSIC
low complexity region 317 329 N/A INTRINSIC
RRM 378 461 4.92e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183269
Predicted Effect probably damaging
Transcript: ENSMUST00000183984
AA Change: R282G

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138974
Gene: ENSMUSG00000002107
AA Change: R282G

DomainStartEndE-ValueType
low complexity region 2 54 N/A INTRINSIC
RRM 104 182 1.29e-17 SMART
RRM 196 271 4.22e-22 SMART
low complexity region 281 310 N/A INTRINSIC
low complexity region 339 366 N/A INTRINSIC
low complexity region 368 380 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the CELF/BRUNOL protein family contain two N-terminal RNA recognition motif (RRM) domains, one C-terminal RRM domain, and a divergent segment of 160-230 aa between the second and third RRM domains. Members of this protein family regulate pre-mRNA alternative splicing and may also be involved in mRNA editing, and translation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G C 17: 24,289,507 T1018R probably damaging Het
Abca8a T C 11: 110,042,105 D1231G probably damaging Het
Adcy7 A G 8: 88,327,393 I1017V probably benign Het
Agpat2 A G 2: 26,597,239 I109T probably damaging Het
Aldh9a1 G A 1: 167,352,628 R97H probably damaging Het
Als2 G A 1: 59,206,538 T593M probably damaging Het
Ap3d1 G C 10: 80,741,908 H28Q possibly damaging Het
Atxn1 A T 13: 45,566,699 D573E probably damaging Het
BC100530 T A 16: 36,367,452 Q17L probably damaging Het
Begain T A 12: 109,033,118 M576L probably benign Het
Bod1l T C 5: 41,838,076 N109S probably damaging Het
Boll A G 1: 55,346,373 M131T possibly damaging Het
Cers2 T C 3: 95,322,459 F330L probably benign Het
Chst13 T C 6: 90,309,158 D274G probably benign Het
Dclk2 A G 3: 86,793,223 V649A probably damaging Het
Deaf1 T C 7: 141,314,454 *54W probably null Het
Fbf1 C T 11: 116,157,688 probably null Het
Fbxo32 C T 15: 58,207,972 S71N probably benign Het
Fbxo42 T A 4: 141,200,510 N700K probably damaging Het
Fis1 T C 5: 136,963,117 I55T possibly damaging Het
Fyco1 A T 9: 123,834,826 L121* probably null Het
Gm2381 G A 7: 42,820,407 P98S probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Gtf2ird1 G A 5: 134,359,007 T946I probably damaging Het
Hmcn1 G T 1: 150,563,599 Y5494* probably null Het
Josd2 A G 7: 44,468,973 probably null Het
Lfng T A 5: 140,611,867 D149E probably damaging Het
Lrp1 C T 10: 127,542,296 A4052T probably damaging Het
Lrrtm3 T C 10: 64,089,031 N119S probably damaging Het
Lypd6 C T 2: 50,165,652 P38L probably damaging Het
Msl3l2 T C 10: 56,115,442 C88R probably benign Het
Nsd1 A G 13: 55,213,692 T158A probably damaging Het
Nudt22 A T 19: 6,993,484 S239R probably benign Het
Odf3 A G 7: 140,849,269 T156A probably benign Het
Olfr1288 T C 2: 111,479,354 M190T probably benign Het
Olfr584 A T 7: 103,086,112 D193V probably damaging Het
Osbpl8 T A 10: 111,269,436 S251T probably benign Het
Otop3 T C 11: 115,344,558 F339L probably damaging Het
Pcdhga10 T A 18: 37,748,200 V338E possibly damaging Het
Pcnx2 A G 8: 125,760,927 F1779S probably damaging Het
Plxna4 T C 6: 32,185,532 K1349E probably damaging Het
Poteg A T 8: 27,481,676 N406I probably benign Het
Ppp4r4 T C 12: 103,606,933 V697A probably benign Het
Ptpra C A 2: 130,544,999 H603Q probably benign Het
Rnf10 T C 5: 115,249,112 D439G probably benign Het
Rnf43 T A 11: 87,732,267 N731K probably benign Het
Slc2a4 T A 11: 69,946,171 N116Y probably damaging Het
Slc6a15 C A 10: 103,404,691 H392N probably benign Het
Slco6d1 C T 1: 98,466,716 T375I probably benign Het
Smpd4 A G 16: 17,642,212 D436G probably damaging Het
Spata22 G A 11: 73,353,745 W311* probably null Het
Syt3 G A 7: 44,393,442 V383I probably benign Het
Tle6 T A 10: 81,594,401 I306F probably damaging Het
Tox3 G A 8: 90,248,390 Q538* probably null Het
Trim24 T A 6: 37,956,453 S656T probably damaging Het
Trnau1ap C A 4: 132,321,734 V119F possibly damaging Het
Vmn1r181 G T 7: 23,984,518 S136I possibly damaging Het
Vmn1r82 T C 7: 12,305,406 V202A probably damaging Het
Zfp607b G A 7: 27,702,394 V92I probably benign Het
Zfp964 G C 8: 69,663,854 C368S unknown Het
Zw10 A G 9: 49,057,641 probably null Het
Other mutations in Celf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Celf2 APN 2 6721577 missense probably benign 0.00
IGL01974:Celf2 APN 2 6604031 missense probably damaging 1.00
IGL02159:Celf2 APN 2 6604177 nonsense probably null
LCD18:Celf2 UTSW 2 6779076 intron probably benign
R0113:Celf2 UTSW 2 6624714 missense probably damaging 1.00
R0511:Celf2 UTSW 2 6604176 missense probably damaging 1.00
R0711:Celf2 UTSW 2 6721415 critical splice donor site probably null
R1755:Celf2 UTSW 2 6884958 start codon destroyed probably benign 0.01
R1802:Celf2 UTSW 2 6549933 missense probably damaging 1.00
R1898:Celf2 UTSW 2 6604164 missense probably damaging 1.00
R1912:Celf2 UTSW 2 6615753 missense probably damaging 1.00
R2422:Celf2 UTSW 2 6553889 missense probably damaging 1.00
R2848:Celf2 UTSW 2 6604125 missense probably damaging 0.96
R3708:Celf2 UTSW 2 6624678 missense probably damaging 1.00
R4295:Celf2 UTSW 2 6604064 missense probably benign 0.10
R4601:Celf2 UTSW 2 6586020 missense possibly damaging 0.87
R4602:Celf2 UTSW 2 6586020 missense possibly damaging 0.87
R4610:Celf2 UTSW 2 6586020 missense possibly damaging 0.87
R4611:Celf2 UTSW 2 6586020 missense possibly damaging 0.87
R4667:Celf2 UTSW 2 6721528 missense probably benign 0.44
R4668:Celf2 UTSW 2 6721528 missense probably benign 0.44
R4669:Celf2 UTSW 2 6721528 missense probably benign 0.44
R4790:Celf2 UTSW 2 6549903 missense probably damaging 1.00
R5022:Celf2 UTSW 2 6607847 intron probably benign
R5369:Celf2 UTSW 2 7081081 intron probably benign
R5540:Celf2 UTSW 2 6553932 missense probably benign 0.43
R5805:Celf2 UTSW 2 6553787 missense probably damaging 1.00
R5913:Celf2 UTSW 2 7081158 start codon destroyed probably null 0.02
R6330:Celf2 UTSW 2 6884955 missense probably benign 0.05
R7505:Celf2 UTSW 2 6624700 missense probably damaging 1.00
R7662:Celf2 UTSW 2 6553917 missense probably damaging 1.00
X0018:Celf2 UTSW 2 6553913 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATCCTGCCCTAATGCTGATTTC -3'
(R):5'- ATTCCATGTGCTCCAGGATAGC -3'

Sequencing Primer
(F):5'- GCTGATTTCATAATTTCTGGGACTC -3'
(R):5'- CATGTGCTCCAGGATAGCTAAGAAAG -3'
Posted On2014-12-04