Incidental Mutation 'R2849:Rnf10'
ID251931
Institutional Source Beutler Lab
Gene Symbol Rnf10
Ensembl Gene ENSMUSG00000041740
Gene Namering finger protein 10
Synonyms
MMRRC Submission 040442-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.590) question?
Stock #R2849 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location115241412-115272898 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115249112 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 439 (D439G)
Ref Sequence ENSEMBL: ENSMUSP00000107726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040555] [ENSMUST00000112096] [ENSMUST00000112097] [ENSMUST00000135455]
Predicted Effect probably benign
Transcript: ENSMUST00000040555
AA Change: D438G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041778
Gene: ENSMUSG00000041740
AA Change: D438G

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 18 31 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
RING 225 266 1.98e-8 SMART
low complexity region 379 400 N/A INTRINSIC
low complexity region 439 461 N/A INTRINSIC
low complexity region 591 618 N/A INTRINSIC
low complexity region 660 671 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112096
AA Change: D438G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107725
Gene: ENSMUSG00000041740
AA Change: D438G

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 18 31 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
RING 225 266 1.98e-8 SMART
low complexity region 379 400 N/A INTRINSIC
low complexity region 439 461 N/A INTRINSIC
low complexity region 591 618 N/A INTRINSIC
low complexity region 660 671 N/A INTRINSIC
low complexity region 782 793 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112097
AA Change: D439G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107726
Gene: ENSMUSG00000041740
AA Change: D439G

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 18 31 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
RING 225 266 1.98e-8 SMART
low complexity region 379 400 N/A INTRINSIC
low complexity region 440 462 N/A INTRINSIC
low complexity region 592 619 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133276
Predicted Effect probably benign
Transcript: ENSMUST00000135455
SMART Domains Protein: ENSMUSP00000118408
Gene: ENSMUSG00000060152

DomainStartEndE-ValueType
Pfam:RNase_P_Rpp14 7 117 3.7e-31 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000139853
AA Change: D400G
SMART Domains Protein: ENSMUSP00000131696
Gene: ENSMUSG00000041740
AA Change: D400G

DomainStartEndE-ValueType
low complexity region 41 53 N/A INTRINSIC
low complexity region 63 77 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
RING 188 229 1.98e-8 SMART
low complexity region 342 363 N/A INTRINSIC
low complexity region 402 424 N/A INTRINSIC
low complexity region 554 581 N/A INTRINSIC
low complexity region 623 634 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152613
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoding this gene is a member of the really interesting new gene finger protein family. Members of this family contain protein motifs similar to zinc finger domains and are involved in many processes that include transcriptional regulation, DNA repair and signal transduction. Expression of this gene is upregulated during neuronal differentiation of cultured cells, and inhibition of its expression impairs differentiation and cell cycle exit, providing evidence for a function in neuronal differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G C 17: 24,289,507 T1018R probably damaging Het
Abca8a T C 11: 110,042,105 D1231G probably damaging Het
Adcy7 A G 8: 88,327,393 I1017V probably benign Het
Agpat2 A G 2: 26,597,239 I109T probably damaging Het
Aldh9a1 G A 1: 167,352,628 R97H probably damaging Het
Als2 G A 1: 59,206,538 T593M probably damaging Het
Ap3d1 G C 10: 80,741,908 H28Q possibly damaging Het
Atxn1 A T 13: 45,566,699 D573E probably damaging Het
BC100530 T A 16: 36,367,452 Q17L probably damaging Het
Begain T A 12: 109,033,118 M576L probably benign Het
Bod1l T C 5: 41,838,076 N109S probably damaging Het
Boll A G 1: 55,346,373 M131T possibly damaging Het
Celf2 T C 2: 6,604,125 R282G probably damaging Het
Cers2 T C 3: 95,322,459 F330L probably benign Het
Chst13 T C 6: 90,309,158 D274G probably benign Het
Dclk2 A G 3: 86,793,223 V649A probably damaging Het
Deaf1 T C 7: 141,314,454 *54W probably null Het
Fbf1 C T 11: 116,157,688 probably null Het
Fbxo32 C T 15: 58,207,972 S71N probably benign Het
Fbxo42 T A 4: 141,200,510 N700K probably damaging Het
Fis1 T C 5: 136,963,117 I55T possibly damaging Het
Fyco1 A T 9: 123,834,826 L121* probably null Het
Gm2381 G A 7: 42,820,407 P98S probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Gtf2ird1 G A 5: 134,359,007 T946I probably damaging Het
Hmcn1 G T 1: 150,563,599 Y5494* probably null Het
Josd2 A G 7: 44,468,973 probably null Het
Lfng T A 5: 140,611,867 D149E probably damaging Het
Lrp1 C T 10: 127,542,296 A4052T probably damaging Het
Lrrtm3 T C 10: 64,089,031 N119S probably damaging Het
Lypd6 C T 2: 50,165,652 P38L probably damaging Het
Msl3l2 T C 10: 56,115,442 C88R probably benign Het
Nsd1 A G 13: 55,213,692 T158A probably damaging Het
Nudt22 A T 19: 6,993,484 S239R probably benign Het
Odf3 A G 7: 140,849,269 T156A probably benign Het
Olfr1288 T C 2: 111,479,354 M190T probably benign Het
Olfr584 A T 7: 103,086,112 D193V probably damaging Het
Osbpl8 T A 10: 111,269,436 S251T probably benign Het
Otop3 T C 11: 115,344,558 F339L probably damaging Het
Pcdhga10 T A 18: 37,748,200 V338E possibly damaging Het
Pcnx2 A G 8: 125,760,927 F1779S probably damaging Het
Plxna4 T C 6: 32,185,532 K1349E probably damaging Het
Poteg A T 8: 27,481,676 N406I probably benign Het
Ppp4r4 T C 12: 103,606,933 V697A probably benign Het
Ptpra C A 2: 130,544,999 H603Q probably benign Het
Rnf43 T A 11: 87,732,267 N731K probably benign Het
Slc2a4 T A 11: 69,946,171 N116Y probably damaging Het
Slc6a15 C A 10: 103,404,691 H392N probably benign Het
Slco6d1 C T 1: 98,466,716 T375I probably benign Het
Smpd4 A G 16: 17,642,212 D436G probably damaging Het
Spata22 G A 11: 73,353,745 W311* probably null Het
Syt3 G A 7: 44,393,442 V383I probably benign Het
Tle6 T A 10: 81,594,401 I306F probably damaging Het
Tox3 G A 8: 90,248,390 Q538* probably null Het
Trim24 T A 6: 37,956,453 S656T probably damaging Het
Trnau1ap C A 4: 132,321,734 V119F possibly damaging Het
Vmn1r181 G T 7: 23,984,518 S136I possibly damaging Het
Vmn1r82 T C 7: 12,305,406 V202A probably damaging Het
Zfp607b G A 7: 27,702,394 V92I probably benign Het
Zfp964 G C 8: 69,663,854 C368S unknown Het
Zw10 A G 9: 49,057,641 probably null Het
Other mutations in Rnf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Rnf10 APN 5 115256983 missense probably damaging 1.00
IGL01995:Rnf10 APN 5 115251102 nonsense probably null
IGL02291:Rnf10 APN 5 115260196 missense probably damaging 1.00
IGL02751:Rnf10 APN 5 115242666 missense probably benign 0.20
IGL02897:Rnf10 APN 5 115248641 missense probably benign
IGL02968:Rnf10 APN 5 115245888 missense probably benign 0.05
IGL03008:Rnf10 APN 5 115251296 missense possibly damaging 0.92
IGL03098:Rnf10 UTSW 5 115272367 missense probably damaging 1.00
R0409:Rnf10 UTSW 5 115255447 splice site probably benign
R1083:Rnf10 UTSW 5 115260104 splice site probably benign
R1754:Rnf10 UTSW 5 115245865 missense probably damaging 0.99
R1957:Rnf10 UTSW 5 115260322 splice site probably benign
R2398:Rnf10 UTSW 5 115247273 missense probably benign 0.33
R2848:Rnf10 UTSW 5 115249112 missense probably benign
R4527:Rnf10 UTSW 5 115260151 missense probably damaging 0.96
R4617:Rnf10 UTSW 5 115248703 missense probably damaging 1.00
R4673:Rnf10 UTSW 5 115251089 missense probably damaging 0.99
R4823:Rnf10 UTSW 5 115255442 critical splice acceptor site probably null
R5560:Rnf10 UTSW 5 115249998 missense probably damaging 1.00
R5805:Rnf10 UTSW 5 115244068 missense probably benign
R6192:Rnf10 UTSW 5 115257077 missense probably damaging 1.00
R7061:Rnf10 UTSW 5 115257090 missense probably damaging 0.98
R7206:Rnf10 UTSW 5 115244121 missense probably benign 0.04
R7213:Rnf10 UTSW 5 115242473 missense probably damaging 1.00
R7213:Rnf10 UTSW 5 115242474 missense probably damaging 1.00
R7429:Rnf10 UTSW 5 115248680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTAACACGGAGAGCTGCTG -3'
(R):5'- TTGGCTGTGTCCTCATGACTAG -3'

Sequencing Primer
(F):5'- CTGAGCTGGGTGAAGCCTG -3'
(R):5'- GCTGTGTCCTCATGACTAGATCTG -3'
Posted On2014-12-04