Incidental Mutation 'R2849:Gtf2ird1'
ID 251935
Institutional Source Beutler Lab
Gene Symbol Gtf2ird1
Ensembl Gene ENSMUSG00000023079
Gene Name general transcription factor II I repeat domain-containing 1
Synonyms ESTM9, BEN, binding factor for early enhancer, MusTRD1, GTF3, Cream1, WBSCR11
MMRRC Submission 040442-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.644) question?
Stock # R2849 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 134386510-134485570 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 134387861 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 946 (T946I)
Ref Sequence ENSEMBL: ENSMUSP00000098219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073161] [ENSMUST00000074114] [ENSMUST00000100650] [ENSMUST00000100652] [ENSMUST00000100654] [ENSMUST00000111244] [ENSMUST00000111245] [ENSMUST00000171794] [ENSMUST00000202280] [ENSMUST00000202829] [ENSMUST00000200944] [ENSMUST00000167084] [ENSMUST00000202554] [ENSMUST00000202104] [ENSMUST00000202321] [ENSMUST00000202165]
AlphaFold Q9JI57
Predicted Effect possibly damaging
Transcript: ENSMUST00000073161
AA Change: T1044I

PolyPhen 2 Score 0.465 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000072904
Gene: ENSMUSG00000023079
AA Change: T1044I

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.5e-29 PFAM
Pfam:GTF2I 351 426 4.9e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.1e-34 PFAM
Pfam:GTF2I 690 765 3.1e-34 PFAM
Pfam:GTF2I 814 889 1.7e-34 PFAM
Pfam:GTF2I 917 992 1.7e-34 PFAM
low complexity region 1020 1043 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074114
AA Change: T941I

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000073752
Gene: ENSMUSG00000023079
AA Change: T941I

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.4e-29 PFAM
Pfam:GTF2I 351 426 4.5e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.1e-34 PFAM
Pfam:GTF2I 690 765 2.8e-34 PFAM
Pfam:GTF2I 814 889 1.6e-34 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100650
AA Change: T1017I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098215
Gene: ENSMUSG00000023079
AA Change: T1017I

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.5e-29 PFAM
Pfam:GTF2I 351 426 4.9e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.2e-34 PFAM
Pfam:GTF2I 690 765 3.1e-34 PFAM
Pfam:GTF2I 787 862 1.8e-34 PFAM
Pfam:GTF2I 890 965 1.8e-34 PFAM
low complexity region 993 1016 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100652
AA Change: T1044I

PolyPhen 2 Score 0.465 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000098217
Gene: ENSMUSG00000023079
AA Change: T1044I

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 5.8e-29 PFAM
Pfam:GTF2I 351 425 6.6e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 2.3e-34 PFAM
Pfam:GTF2I 690 764 3.3e-32 PFAM
Pfam:GTF2I 814 888 3e-33 PFAM
Pfam:GTF2I 917 991 3e-33 PFAM
low complexity region 1020 1043 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100654
AA Change: T946I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098219
Gene: ENSMUSG00000023079
AA Change: T946I

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.3e-29 PFAM
Pfam:GTF2I 351 426 4.3e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1e-34 PFAM
Pfam:GTF2I 716 791 1.5e-34 PFAM
Pfam:GTF2I 819 894 1.5e-34 PFAM
low complexity region 922 945 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000111244
AA Change: T1017I
SMART Domains Protein: ENSMUSP00000106875
Gene: ENSMUSG00000023079
AA Change: T1017I

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 4.3e-29 PFAM
Pfam:GTF2I 351 425 4.9e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 1.7e-34 PFAM
Pfam:GTF2I 690 764 2.5e-32 PFAM
Pfam:GTF2I 787 861 2.3e-33 PFAM
Pfam:GTF2I 890 964 2.3e-33 PFAM
low complexity region 993 1016 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111245
AA Change: T998I

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000106876
Gene: ENSMUSG00000023079
AA Change: T998I

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.4e-29 PFAM
Pfam:GTF2I 351 426 4.6e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.1e-34 PFAM
Pfam:GTF2I 671 746 2.9e-34 PFAM
Pfam:GTF2I 768 843 1.7e-34 PFAM
Pfam:GTF2I 871 946 1.7e-34 PFAM
low complexity region 974 997 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000171794
AA Change: T1017I
SMART Domains Protein: ENSMUSP00000129392
Gene: ENSMUSG00000023079
AA Change: T1017I

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.2e-29 PFAM
Pfam:GTF2I 351 426 3.8e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 8.9e-35 PFAM
Pfam:GTF2I 690 765 2.4e-34 PFAM
Pfam:GTF2I 787 862 1.4e-34 PFAM
Pfam:GTF2I 890 965 1.4e-34 PFAM
low complexity region 993 1016 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202280
AA Change: T914I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143897
Gene: ENSMUSG00000023079
AA Change: T914I

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 2.6e-26 PFAM
Pfam:GTF2I 351 425 2.9e-29 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 1e-31 PFAM
Pfam:GTF2I 690 764 1.5e-29 PFAM
Pfam:GTF2I 787 861 1.3e-30 PFAM
low complexity region 890 913 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202829
AA Change: T317I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144604
Gene: ENSMUSG00000023079
AA Change: T317I

DomainStartEndE-ValueType
Pfam:GTF2I 1 44 1.4e-15 PFAM
Pfam:GTF2I 87 161 4.6e-34 PFAM
Pfam:GTF2I 190 264 4.6e-34 PFAM
low complexity region 293 316 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000200944
AA Change: T941I

PolyPhen 2 Score 0.632 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143848
Gene: ENSMUSG00000023079
AA Change: T941I

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 4.9e-29 PFAM
Pfam:GTF2I 351 425 5.6e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 2e-34 PFAM
Pfam:GTF2I 690 764 2.8e-32 PFAM
Pfam:GTF2I 814 888 2.6e-33 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000167084
AA Change: T941I

PolyPhen 2 Score 0.632 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132882
Gene: ENSMUSG00000023079
AA Change: T941I

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.3e-29 PFAM
Pfam:GTF2I 351 426 4.3e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1e-34 PFAM
Pfam:GTF2I 690 765 2.7e-34 PFAM
Pfam:GTF2I 814 889 1.5e-34 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202554
AA Change: T998I

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143809
Gene: ENSMUSG00000023079
AA Change: T998I

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 5.5e-29 PFAM
Pfam:GTF2I 351 425 6.3e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 2.2e-34 PFAM
Pfam:GTF2I 671 745 3.2e-32 PFAM
Pfam:GTF2I 768 842 2.9e-33 PFAM
Pfam:GTF2I 871 945 2.9e-33 PFAM
low complexity region 974 997 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201608
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202268
Predicted Effect probably benign
Transcript: ENSMUST00000202104
SMART Domains Protein: ENSMUSP00000144203
Gene: ENSMUSG00000023079

DomainStartEndE-ValueType
Pfam:GTF2I 1 29 7.9e-7 PFAM
Pfam:GTF2I 58 132 7.3e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201495
Predicted Effect probably benign
Transcript: ENSMUST00000202321
Predicted Effect probably benign
Transcript: ENSMUST00000202165
SMART Domains Protein: ENSMUSP00000144420
Gene: ENSMUSG00000023079

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
Pfam:GTF2I 35 109 7.6e-33 PFAM
Pfam:GTF2I 167 193 4.2e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains five GTF2I-like repeats and each repeat possesses a potential helix-loop-helix (HLH) motif. It may have the ability to interact with other HLH-proteins and function as a transcription factor or as a positive transcriptional regulator under the control of Retinoblastoma protein. This gene plays a role in craniofacial and cognitive development and mutations have been associated with Williams-Beuren syndrome, a multisystem developmental disorder caused by deletion of multiple genes at 7q11.23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygotes for one null allele is embryonic lethal with abnormal yolk sac vasulogenesis, abnormal angiogenesis, and neural tube defect. Other null allele homozygous mice are viable and have behavioral defects and exhibit a mild craniofacial defect withvariable penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G C 17: 24,508,481 (GRCm39) T1018R probably damaging Het
Abca8a T C 11: 109,932,931 (GRCm39) D1231G probably damaging Het
Adcy7 A G 8: 89,054,021 (GRCm39) I1017V probably benign Het
Agpat2 A G 2: 26,487,251 (GRCm39) I109T probably damaging Het
Aldh9a1 G A 1: 167,180,197 (GRCm39) R97H probably damaging Het
Als2 G A 1: 59,245,697 (GRCm39) T593M probably damaging Het
Ap3d1 G C 10: 80,577,742 (GRCm39) H28Q possibly damaging Het
Atxn1 A T 13: 45,720,175 (GRCm39) D573E probably damaging Het
Begain T A 12: 108,999,044 (GRCm39) M576L probably benign Het
Bod1l T C 5: 41,995,419 (GRCm39) N109S probably damaging Het
Boll A G 1: 55,385,532 (GRCm39) M131T possibly damaging Het
Celf2 T C 2: 6,608,936 (GRCm39) R282G probably damaging Het
Cers2 T C 3: 95,229,770 (GRCm39) F330L probably benign Het
Chst13 T C 6: 90,286,140 (GRCm39) D274G probably benign Het
Cimap1a A G 7: 140,429,182 (GRCm39) T156A probably benign Het
Cstdc5 T A 16: 36,187,814 (GRCm39) Q17L probably damaging Het
Dclk2 A G 3: 86,700,530 (GRCm39) V649A probably damaging Het
Deaf1 T C 7: 140,894,367 (GRCm39) *54W probably null Het
Fbf1 C T 11: 116,048,514 (GRCm39) probably null Het
Fbxo32 C T 15: 58,071,368 (GRCm39) S71N probably benign Het
Fbxo42 T A 4: 140,927,821 (GRCm39) N700K probably damaging Het
Fis1 T C 5: 136,991,971 (GRCm39) I55T possibly damaging Het
Fyco1 A T 9: 123,663,891 (GRCm39) L121* probably null Het
Gm2381 G A 7: 42,469,831 (GRCm39) P98S probably damaging Het
Grm7 G T 6: 110,623,309 (GRCm39) V161F probably damaging Het
Hmcn1 G T 1: 150,439,350 (GRCm39) Y5494* probably null Het
Josd2 A G 7: 44,118,397 (GRCm39) probably null Het
Lfng T A 5: 140,597,622 (GRCm39) D149E probably damaging Het
Lrp1 C T 10: 127,378,165 (GRCm39) A4052T probably damaging Het
Lrrtm3 T C 10: 63,924,810 (GRCm39) N119S probably damaging Het
Lypd6 C T 2: 50,055,664 (GRCm39) P38L probably damaging Het
Msl3l2 T C 10: 55,991,538 (GRCm39) C88R probably benign Het
Nsd1 A G 13: 55,361,505 (GRCm39) T158A probably damaging Het
Nudt22 A T 19: 6,970,852 (GRCm39) S239R probably benign Het
Or4g7 T C 2: 111,309,699 (GRCm39) M190T probably benign Het
Or52r1c A T 7: 102,735,319 (GRCm39) D193V probably damaging Het
Osbpl8 T A 10: 111,105,297 (GRCm39) S251T probably benign Het
Otop3 T C 11: 115,235,384 (GRCm39) F339L probably damaging Het
Pcdhga10 T A 18: 37,881,253 (GRCm39) V338E possibly damaging Het
Pcnx2 A G 8: 126,487,666 (GRCm39) F1779S probably damaging Het
Plxna4 T C 6: 32,162,467 (GRCm39) K1349E probably damaging Het
Poteg A T 8: 27,971,704 (GRCm39) N406I probably benign Het
Ppp4r4 T C 12: 103,573,192 (GRCm39) V697A probably benign Het
Ptpra C A 2: 130,386,919 (GRCm39) H603Q probably benign Het
Rnf10 T C 5: 115,387,171 (GRCm39) D439G probably benign Het
Rnf43 T A 11: 87,623,093 (GRCm39) N731K probably benign Het
Slc2a4 T A 11: 69,836,997 (GRCm39) N116Y probably damaging Het
Slc6a15 C A 10: 103,240,552 (GRCm39) H392N probably benign Het
Slco6d1 C T 1: 98,394,441 (GRCm39) T375I probably benign Het
Smpd4 A G 16: 17,460,076 (GRCm39) D436G probably damaging Het
Spata22 G A 11: 73,244,571 (GRCm39) W311* probably null Het
Syt3 G A 7: 44,042,866 (GRCm39) V383I probably benign Het
Tle6 T A 10: 81,430,235 (GRCm39) I306F probably damaging Het
Tox3 G A 8: 90,975,018 (GRCm39) Q538* probably null Het
Trim24 T A 6: 37,933,388 (GRCm39) S656T probably damaging Het
Trnau1ap C A 4: 132,049,045 (GRCm39) V119F possibly damaging Het
Vmn1r181 G T 7: 23,683,943 (GRCm39) S136I possibly damaging Het
Vmn1r82 T C 7: 12,039,333 (GRCm39) V202A probably damaging Het
Zfp607b G A 7: 27,401,819 (GRCm39) V92I probably benign Het
Zfp964 G C 8: 70,116,504 (GRCm39) C368S unknown Het
Zw10 A G 9: 48,968,941 (GRCm39) probably null Het
Other mutations in Gtf2ird1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00558:Gtf2ird1 APN 5 134,387,745 (GRCm39) missense probably benign 0.03
IGL02477:Gtf2ird1 APN 5 134,408,832 (GRCm39) missense probably damaging 1.00
IGL02659:Gtf2ird1 APN 5 134,405,895 (GRCm39) missense probably damaging 1.00
IGL02752:Gtf2ird1 APN 5 134,387,678 (GRCm39) makesense probably null
IGL02963:Gtf2ird1 APN 5 134,418,541 (GRCm39) missense probably benign 0.05
IGL03328:Gtf2ird1 APN 5 134,417,983 (GRCm39) critical splice donor site probably null
IGL03379:Gtf2ird1 APN 5 134,411,392 (GRCm39) missense possibly damaging 0.94
R0585:Gtf2ird1 UTSW 5 134,405,796 (GRCm39) missense probably damaging 1.00
R1199:Gtf2ird1 UTSW 5 134,439,918 (GRCm39) missense possibly damaging 0.85
R1388:Gtf2ird1 UTSW 5 134,424,564 (GRCm39) missense probably damaging 1.00
R1470:Gtf2ird1 UTSW 5 134,424,656 (GRCm39) critical splice acceptor site probably null
R1470:Gtf2ird1 UTSW 5 134,424,656 (GRCm39) critical splice acceptor site probably null
R1544:Gtf2ird1 UTSW 5 134,387,772 (GRCm39) missense possibly damaging 0.93
R1652:Gtf2ird1 UTSW 5 134,424,567 (GRCm39) missense probably damaging 1.00
R1792:Gtf2ird1 UTSW 5 134,395,790 (GRCm39) splice site probably null
R1852:Gtf2ird1 UTSW 5 134,411,434 (GRCm39) splice site probably null
R1938:Gtf2ird1 UTSW 5 134,444,099 (GRCm39) missense probably damaging 1.00
R1996:Gtf2ird1 UTSW 5 134,405,740 (GRCm39) splice site probably benign
R2020:Gtf2ird1 UTSW 5 134,445,947 (GRCm39) missense probably damaging 1.00
R2025:Gtf2ird1 UTSW 5 134,392,788 (GRCm39) missense probably damaging 1.00
R2964:Gtf2ird1 UTSW 5 134,386,538 (GRCm39) splice site probably null
R3421:Gtf2ird1 UTSW 5 134,417,354 (GRCm39) missense probably benign 0.41
R4543:Gtf2ird1 UTSW 5 134,392,754 (GRCm39) critical splice donor site probably null
R4569:Gtf2ird1 UTSW 5 134,439,857 (GRCm39) missense probably damaging 1.00
R4664:Gtf2ird1 UTSW 5 134,412,756 (GRCm39) missense probably damaging 1.00
R4665:Gtf2ird1 UTSW 5 134,412,756 (GRCm39) missense probably damaging 1.00
R4666:Gtf2ird1 UTSW 5 134,412,756 (GRCm39) missense probably damaging 1.00
R4680:Gtf2ird1 UTSW 5 134,386,735 (GRCm39) missense probably damaging 1.00
R4709:Gtf2ird1 UTSW 5 134,433,588 (GRCm39) missense probably benign
R4806:Gtf2ird1 UTSW 5 134,412,750 (GRCm39) missense probably damaging 0.99
R4823:Gtf2ird1 UTSW 5 134,424,576 (GRCm39) missense probably damaging 1.00
R4857:Gtf2ird1 UTSW 5 134,391,398 (GRCm39) missense probably damaging 0.96
R4970:Gtf2ird1 UTSW 5 134,431,038 (GRCm39) missense probably damaging 1.00
R4974:Gtf2ird1 UTSW 5 134,386,685 (GRCm39) nonsense probably null
R4975:Gtf2ird1 UTSW 5 134,424,481 (GRCm39) missense probably damaging 1.00
R5072:Gtf2ird1 UTSW 5 134,419,787 (GRCm39) splice site probably null
R5112:Gtf2ird1 UTSW 5 134,431,038 (GRCm39) missense probably damaging 1.00
R5653:Gtf2ird1 UTSW 5 134,439,821 (GRCm39) missense probably damaging 1.00
R5681:Gtf2ird1 UTSW 5 134,392,172 (GRCm39) missense probably damaging 1.00
R5738:Gtf2ird1 UTSW 5 134,412,672 (GRCm39) missense probably damaging 1.00
R5753:Gtf2ird1 UTSW 5 134,439,837 (GRCm39) missense probably damaging 1.00
R6385:Gtf2ird1 UTSW 5 134,433,544 (GRCm39) missense probably benign 0.19
R6580:Gtf2ird1 UTSW 5 134,389,893 (GRCm39) missense probably damaging 1.00
R6787:Gtf2ird1 UTSW 5 134,392,766 (GRCm39) missense probably damaging 0.99
R6981:Gtf2ird1 UTSW 5 134,412,776 (GRCm39) splice site probably benign
R7208:Gtf2ird1 UTSW 5 134,439,948 (GRCm39) missense probably benign 0.35
R7271:Gtf2ird1 UTSW 5 134,433,758 (GRCm39) missense probably benign 0.01
R7517:Gtf2ird1 UTSW 5 134,391,379 (GRCm39) missense probably benign
R7786:Gtf2ird1 UTSW 5 134,419,753 (GRCm39) nonsense probably null
R7788:Gtf2ird1 UTSW 5 134,445,985 (GRCm39) nonsense probably null
R7850:Gtf2ird1 UTSW 5 134,392,069 (GRCm39) missense probably benign 0.21
R7866:Gtf2ird1 UTSW 5 134,392,063 (GRCm39) missense probably benign 0.01
R8183:Gtf2ird1 UTSW 5 134,386,689 (GRCm39) missense unknown
R8712:Gtf2ird1 UTSW 5 134,444,064 (GRCm39) missense probably damaging 1.00
R8844:Gtf2ird1 UTSW 5 134,389,879 (GRCm39) nonsense probably null
R9473:Gtf2ird1 UTSW 5 134,433,534 (GRCm39) missense probably benign 0.08
R9669:Gtf2ird1 UTSW 5 134,408,794 (GRCm39) missense probably damaging 0.99
R9737:Gtf2ird1 UTSW 5 134,408,794 (GRCm39) missense probably damaging 0.99
X0026:Gtf2ird1 UTSW 5 134,404,956 (GRCm39) splice site probably null
Z1176:Gtf2ird1 UTSW 5 134,438,166 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CAAAACGAGTGGATGTGCCTG -3'
(R):5'- CTGGTTTCTTAGGGCATCAAAATG -3'

Sequencing Primer
(F):5'- CTGCCCCTCTGTGGTTGG -3'
(R):5'- ATCTAAAAGCCGGGACTTTCTC -3'
Posted On 2014-12-04