Incidental Mutation 'R2849:Lfng'
ID251939
Institutional Source Beutler Lab
Gene Symbol Lfng
Ensembl Gene ENSMUSG00000029570
Gene NameLFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Synonymslunatic fringe
MMRRC Submission 040442-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.815) question?
Stock #R2849 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location140607320-140615545 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 140611867 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 149 (D149E)
Ref Sequence ENSEMBL: ENSMUSP00000031555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031555]
Predicted Effect probably damaging
Transcript: ENSMUST00000031555
AA Change: D149E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031555
Gene: ENSMUSG00000029570
AA Change: D149E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 37 60 N/A INTRINSIC
Pfam:Fringe 107 357 9.6e-124 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200626
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the fringe gene family which also includes radical and manic fringe genes. They all encode evolutionarily conserved glycosyltransferases that act in the Notch signaling pathway to define boundaries during embryonic development. While their genomic structure is distinct from other glycosyltransferases, fringe proteins have a fucose-specific beta-1,3-N-acetylglucosaminyltransferase activity that leads to elongation of O-linked fucose residues on Notch, which alters Notch signaling. This gene product is predicted to be a single-pass type II Golgi membrane protein but it may also be secreted and proteolytically processed like the related proteins in mouse and Drosophila (PMID: 9187150). Mutations in this gene have been associated with autosomal recessive spondylocostal dysostosis 3. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a short tail and abnormal rib, somite, and lung development. Mice homozygous mice exhibit reduced female fertility, abnormal hair cells, and abnormal axial skeleton morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G C 17: 24,289,507 T1018R probably damaging Het
Abca8a T C 11: 110,042,105 D1231G probably damaging Het
Adcy7 A G 8: 88,327,393 I1017V probably benign Het
Agpat2 A G 2: 26,597,239 I109T probably damaging Het
Aldh9a1 G A 1: 167,352,628 R97H probably damaging Het
Als2 G A 1: 59,206,538 T593M probably damaging Het
Ap3d1 G C 10: 80,741,908 H28Q possibly damaging Het
Atxn1 A T 13: 45,566,699 D573E probably damaging Het
BC100530 T A 16: 36,367,452 Q17L probably damaging Het
Begain T A 12: 109,033,118 M576L probably benign Het
Bod1l T C 5: 41,838,076 N109S probably damaging Het
Boll A G 1: 55,346,373 M131T possibly damaging Het
Celf2 T C 2: 6,604,125 R282G probably damaging Het
Cers2 T C 3: 95,322,459 F330L probably benign Het
Chst13 T C 6: 90,309,158 D274G probably benign Het
Dclk2 A G 3: 86,793,223 V649A probably damaging Het
Deaf1 T C 7: 141,314,454 *54W probably null Het
Fbf1 C T 11: 116,157,688 probably null Het
Fbxo32 C T 15: 58,207,972 S71N probably benign Het
Fbxo42 T A 4: 141,200,510 N700K probably damaging Het
Fis1 T C 5: 136,963,117 I55T possibly damaging Het
Fyco1 A T 9: 123,834,826 L121* probably null Het
Gm2381 G A 7: 42,820,407 P98S probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Gtf2ird1 G A 5: 134,359,007 T946I probably damaging Het
Hmcn1 G T 1: 150,563,599 Y5494* probably null Het
Josd2 A G 7: 44,468,973 probably null Het
Lrp1 C T 10: 127,542,296 A4052T probably damaging Het
Lrrtm3 T C 10: 64,089,031 N119S probably damaging Het
Lypd6 C T 2: 50,165,652 P38L probably damaging Het
Msl3l2 T C 10: 56,115,442 C88R probably benign Het
Nsd1 A G 13: 55,213,692 T158A probably damaging Het
Nudt22 A T 19: 6,993,484 S239R probably benign Het
Odf3 A G 7: 140,849,269 T156A probably benign Het
Olfr1288 T C 2: 111,479,354 M190T probably benign Het
Olfr584 A T 7: 103,086,112 D193V probably damaging Het
Osbpl8 T A 10: 111,269,436 S251T probably benign Het
Otop3 T C 11: 115,344,558 F339L probably damaging Het
Pcdhga10 T A 18: 37,748,200 V338E possibly damaging Het
Pcnx2 A G 8: 125,760,927 F1779S probably damaging Het
Plxna4 T C 6: 32,185,532 K1349E probably damaging Het
Poteg A T 8: 27,481,676 N406I probably benign Het
Ppp4r4 T C 12: 103,606,933 V697A probably benign Het
Ptpra C A 2: 130,544,999 H603Q probably benign Het
Rnf10 T C 5: 115,249,112 D439G probably benign Het
Rnf43 T A 11: 87,732,267 N731K probably benign Het
Slc2a4 T A 11: 69,946,171 N116Y probably damaging Het
Slc6a15 C A 10: 103,404,691 H392N probably benign Het
Slco6d1 C T 1: 98,466,716 T375I probably benign Het
Smpd4 A G 16: 17,642,212 D436G probably damaging Het
Spata22 G A 11: 73,353,745 W311* probably null Het
Syt3 G A 7: 44,393,442 V383I probably benign Het
Tle6 T A 10: 81,594,401 I306F probably damaging Het
Tox3 G A 8: 90,248,390 Q538* probably null Het
Trim24 T A 6: 37,956,453 S656T probably damaging Het
Trnau1ap C A 4: 132,321,734 V119F possibly damaging Het
Vmn1r181 G T 7: 23,984,518 S136I possibly damaging Het
Vmn1r82 T C 7: 12,305,406 V202A probably damaging Het
Zfp607b G A 7: 27,702,394 V92I probably benign Het
Zfp964 G C 8: 69,663,854 C368S unknown Het
Zw10 A G 9: 49,057,641 probably null Het
Other mutations in Lfng
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Lfng APN 5 140612535 missense probably damaging 1.00
zigzag UTSW 5 140612535 missense probably damaging 1.00
PIT4305001:Lfng UTSW 5 140612528 missense probably damaging 1.00
R2070:Lfng UTSW 5 140612595 missense possibly damaging 0.63
R2848:Lfng UTSW 5 140611867 missense probably damaging 1.00
R4689:Lfng UTSW 5 140614439 missense probably damaging 0.99
R4936:Lfng UTSW 5 140612395 splice site probably null
R5516:Lfng UTSW 5 140613263 missense probably damaging 1.00
R5560:Lfng UTSW 5 140614267 missense possibly damaging 0.89
R6334:Lfng UTSW 5 140612767 missense possibly damaging 0.86
R6380:Lfng UTSW 5 140614396 splice site probably null
R6627:Lfng UTSW 5 140607768 missense probably damaging 1.00
R7832:Lfng UTSW 5 140612833 missense probably benign 0.07
R7853:Lfng UTSW 5 140607629 missense probably benign 0.01
R7915:Lfng UTSW 5 140612833 missense probably benign 0.07
R7936:Lfng UTSW 5 140607629 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTGAAGTTGGAGAGTGAGCCC -3'
(R):5'- CTCTGCATAAGAATCGGGGC -3'

Sequencing Primer
(F):5'- TTGGAGAGTGAGCCCACCTC -3'
(R):5'- GAGTGAACTGGCCTCTTA -3'
Posted On2014-12-04