Mutagenetix > Incidental Mutations

Incidental Mutation 'R2510:Pitpnm2'

251942

Institutional Source

Beutler Lab

Gene Symbol

Pitpnm2

Ensembl Gene

ENSMUSG00000029406

Gene Name

phosphatidylinositol transfer protein, membrane-associated 2

Synonyms

NIR3, RDGBA2, Rdgb2

MMRRC Submission

040416-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2510 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

124118690-124249760 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 124136326 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 240 (E240G)

Ref Sequence

ENSEMBL: ENSMUSP00000124292 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086123] [ENSMUST00000159677] [ENSMUST00000161273] [ENSMUST00000161938] [ENSMUST00000162812]

Predicted Effect

probably benign
Transcript: ENSMUST00000086123
AA Change: E240G

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000083292
Gene: ENSMUSG00000029406
AA Change: E240G

Domain	Start	End	E-Value	Type
Pfam:IP_trans	1	253	6.1e-132	PFAM
low complexity region	298	319	N/A	INTRINSIC
low complexity region	333	344	N/A	INTRINSIC
low complexity region	507	515	N/A	INTRINSIC
Blast:DDHD	548	570	6e-7	BLAST
low complexity region	571	589	N/A	INTRINSIC
low complexity region	608	630	N/A	INTRINSIC
low complexity region	682	689	N/A	INTRINSIC
DDHD	701	895	1.66e-98	SMART
LNS2	1040	1171	3.22e-55	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000159677
AA Change: E240G

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000143269
Gene: ENSMUSG00000029406
AA Change: E240G

Domain	Start	End	E-Value	Type
Pfam:IP_trans	1	253	3.2e-130	PFAM
low complexity region	298	319	N/A	INTRINSIC
low complexity region	333	344	N/A	INTRINSIC
low complexity region	420	436	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000161273
AA Change: E240G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000124292
Gene: ENSMUSG00000029406
AA Change: E240G

Domain	Start	End	E-Value	Type
Pfam:IP_trans	1	253	3.2e-129	PFAM
low complexity region	298	319	N/A	INTRINSIC
low complexity region	333	344	N/A	INTRINSIC
Blast:DDHD	422	670	2e-65	BLAST
low complexity region	682	689	N/A	INTRINSIC
DDHD	701	945	7.5e-100	SMART
LNS2	1090	1221	3.1e-59	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161530

Predicted Effect

probably benign
Transcript: ENSMUST00000161938
AA Change: E240G

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000124111
Gene: ENSMUSG00000029406
AA Change: E240G

Domain	Start	End	E-Value	Type
Pfam:IP_trans	1	251	7.5e-116	PFAM
low complexity region	298	319	N/A	INTRINSIC
low complexity region	333	344	N/A	INTRINSIC
Blast:DDHD	422	670	2e-65	BLAST
low complexity region	682	689	N/A	INTRINSIC
DDHD	701	949	8.37e-104	SMART
LNS2	1094	1225	3.22e-55	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000162812
AA Change: E240G

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000124740
Gene: ENSMUSG00000029406
AA Change: E240G

Domain	Start	End	E-Value	Type
Pfam:IP_trans	1	253	6.1e-132	PFAM
low complexity region	298	319	N/A	INTRINSIC
low complexity region	333	344	N/A	INTRINSIC
low complexity region	507	515	N/A	INTRINSIC
Blast:DDHD	548	570	6e-7	BLAST
low complexity region	571	589	N/A	INTRINSIC
low complexity region	608	630	N/A	INTRINSIC
low complexity region	682	689	N/A	INTRINSIC
DDHD	701	895	1.66e-98	SMART
LNS2	1040	1171	3.22e-55	SMART

Meta Mutation Damage Score

0.2834

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 94.9%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PITPNM2 belongs to a family of membrane-associated phosphatidylinositol transfer domain-containing proteins that share homology with the Drosophila retinal degeneration B (rdgB) protein (Ocaka et al., 2005 [PubMed 15627748]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no defects pertaining to photoreceptor function or survival. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	T	C	1: 37,625,300	M506V	probably benign	Het
4930571K23Rik	C	A	7: 125,369,139		noncoding transcript	Het
Adra1d	C	A	2: 131,562,135	E12*	probably null	Het
Ago4	A	T	4: 126,517,071	D208E	probably damaging	Het
Agrn	A	T	4: 156,166,424		probably null	Het
Atxn2	C	T	5: 121,781,393	S388L	probably damaging	Het
Bbox1	A	T	2: 110,305,631	M1K	probably null	Het
Btaf1	G	A	19: 37,002,445	R1538H	probably benign	Het
Car11	G	A	7: 45,701,359	G93E	probably damaging	Het
Col18a1	A	G	10: 77,096,268	L329P	unknown	Het
Copb2	T	A	9: 98,571,648		probably benign	Het
Dnah2	G	T	11: 69,524,206	S234*	probably null	Het
Dnah9	T	C	11: 66,005,169	Y2460C	probably damaging	Het
Dnaic2	G	C	11: 114,757,167		probably benign	Het
Dst	C	A	1: 34,212,286	T1814K	probably benign	Het
F11	A	G	8: 45,248,638	S353P	probably damaging	Het
Fancm	A	T	12: 65,113,770		probably benign	Het
Fsip2	T	C	2: 82,986,438	S4172P	probably benign	Het
G530012D18Rik	T	G	1: 85,577,204		probably benign	Het
Gca	T	G	2: 62,689,974	S159R	probably damaging	Het
Gja8	T	G	3: 96,919,717	T210P	probably damaging	Het
Gm10639	T	A	9: 78,294,807	M1K	probably null	Het
Gm13103	G	A	4: 143,851,991	V274I	probably benign	Het
Gm5117	T	A	8: 31,738,355		noncoding transcript	Het
Gm5900	T	A	7: 104,950,364		noncoding transcript	Het
Gpi1	A	G	7: 34,205,923	S359P	probably damaging	Het
Grm5	A	G	7: 88,036,091	E472G	probably benign	Het
Hoxd12	G	A	2: 74,675,471	A129T	possibly damaging	Het
Ifnlr1	G	T	4: 135,705,248	D332Y	probably damaging	Het
Ift140	T	C	17: 25,036,308	I466T	probably benign	Het
Kansl2	A	G	15: 98,528,861		probably null	Het
Kat2a	T	C	11: 100,712,142	Q88R	probably benign	Het
Kcnh7	T	C	2: 62,721,917	D910G	probably benign	Het
Klk1b1	T	C	7: 43,969,379	V60A	probably damaging	Het
Krt7	A	C	15: 101,412,657	I62L	probably benign	Het
Llgl1	A	G	11: 60,710,036	K653E	probably damaging	Het
Lmo2	T	C	2: 103,981,062	Y147H	probably damaging	Het
Mafb	T	G	2: 160,366,576	E34A	probably damaging	Het
Meiob	T	C	17: 24,816,597		probably benign	Het
Mllt10	C	A	2: 18,065,124	D30E	possibly damaging	Het
Mprip	T	A	11: 59,749,508		probably benign	Het
Muc5b	A	T	7: 141,859,061	N1915Y	unknown	Het
Mycbp2	C	T	14: 103,155,255	R3290Q	probably damaging	Het
Obscn	G	A	11: 59,042,314		probably benign	Het
Olfm3	T	A	3: 115,122,310	V277D	probably damaging	Het
Olfr1271	C	T	2: 90,265,606	V275I	probably damaging	Het
Olfr1286	G	A	2: 111,420,451	P167S	possibly damaging	Het
Olfr668	G	A	7: 104,925,687	H26Y	probably benign	Het
Olfr960	T	A	9: 39,623,431	F101I	probably damaging	Het
Omp	A	T	7: 98,145,345	M25K	possibly damaging	Het
Otoa	C	T	7: 121,160,472	T1099I	probably benign	Het
Pcdh15	T	G	10: 74,631,499	S1715A	probably benign	Het
Pcnx4	T	C	12: 72,566,972	W564R	probably damaging	Het
Pde12	T	C	14: 26,665,526	*609W	probably null	Het
Plppr4	G	T	3: 117,331,706	N161K	probably damaging	Het
Ppp1r37	T	C	7: 19,532,432	K470E	possibly damaging	Het
Ptprd	C	A	4: 76,086,011		probably null	Het
Rgs9	T	C	11: 109,268,972	Y178C	probably benign	Het
Rims2	T	G	15: 39,585,652	S1217R	probably damaging	Het
Rorc	C	T	3: 94,389,120	T208I	probably benign	Het
Ryr3	C	T	2: 112,675,904	E3458K	probably benign	Het
Scn5a	A	T	9: 119,533,685	V623E	probably benign	Het
Slc28a2	C	T	2: 122,451,016	Q229*	probably null	Het
Slc35f3	C	T	8: 126,298,706		probably benign	Het
Spg11	T	G	2: 122,075,310	I1285L	probably benign	Het
Sstr2	A	T	11: 113,624,923	I223F	probably damaging	Het
Susd1	A	T	4: 59,349,855	V527E	possibly damaging	Het
Tas1r2	A	G	4: 139,659,851	N207S	probably damaging	Het
Tmem57	A	G	4: 134,804,388	S657P	probably damaging	Het
Trappc10	A	G	10: 78,211,523	S380P	possibly damaging	Het
Ttn	T	C	2: 76,740,992	D26519G	probably damaging	Het
Vmn1r215	A	G	13: 23,076,173	I128V	probably benign	Het
Vmn1r37	T	C	6: 66,731,951	L150P	probably damaging	Het
Vmn2r52	G	T	7: 10,170,868	A348E	probably benign	Het
Vmn2r-ps159	G	T	4: 156,334,397		noncoding transcript	Het
Wdyhv1	C	A	15: 58,153,624	A145D	probably damaging	Het
Ypel5	T	C	17: 72,846,391	L30P	probably damaging	Het
Zfp985	A	G	4: 147,582,986	T104A	possibly damaging	Het

Other mutations in Pitpnm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00930:Pitpnm2	APN	5	124121663	unclassified	probably benign
IGL01660:Pitpnm2	APN	5	124123194	missense	probably damaging	1.00
IGL02328:Pitpnm2	APN	5	124121414	missense	probably damaging	0.99
IGL02340:Pitpnm2	APN	5	124130613	missense	probably damaging	1.00
IGL02399:Pitpnm2	APN	5	124140758	splice site	probably benign
IGL02719:Pitpnm2	APN	5	124140602	missense	probably damaging	1.00
IGL03053:Pitpnm2	APN	5	124143601	missense	probably damaging	1.00
IGL03083:Pitpnm2	APN	5	124133382	missense	possibly damaging	0.92
PIT4131001:Pitpnm2	UTSW	5	124131115	missense	probably benign	0.01
R0058:Pitpnm2	UTSW	5	124124030	missense	probably damaging	1.00
R0437:Pitpnm2	UTSW	5	124131089	splice site	probably benign
R0530:Pitpnm2	UTSW	5	124131201	missense	probably damaging	1.00
R0568:Pitpnm2	UTSW	5	124140517	splice site	probably benign
R0926:Pitpnm2	UTSW	5	124131209	missense	probably benign	0.10
R1625:Pitpnm2	UTSW	5	124133433	missense	probably benign	0.05
R2008:Pitpnm2	UTSW	5	124152621	start codon destroyed	probably damaging	0.99
R2120:Pitpnm2	UTSW	5	124127269	missense	probably damaging	1.00
R2354:Pitpnm2	UTSW	5	124122919	missense	probably damaging	0.99
R2448:Pitpnm2	UTSW	5	124123994	missense	probably damaging	1.00
R2509:Pitpnm2	UTSW	5	124136326	missense	probably damaging	0.99
R2511:Pitpnm2	UTSW	5	124136326	missense	probably damaging	0.99
R2520:Pitpnm2	UTSW	5	124129401	missense	probably damaging	0.96
R2860:Pitpnm2	UTSW	5	124121437	missense	probably damaging	1.00
R2861:Pitpnm2	UTSW	5	124121437	missense	probably damaging	1.00
R4407:Pitpnm2	UTSW	5	124152615	missense	possibly damaging	0.57
R4417:Pitpnm2	UTSW	5	124123569	missense	probably damaging	1.00
R4426:Pitpnm2	UTSW	5	124142123	missense	probably benign	0.32
R4458:Pitpnm2	UTSW	5	124121376	missense	probably benign	0.00
R4610:Pitpnm2	UTSW	5	124125371	missense	probably damaging	0.99
R4786:Pitpnm2	UTSW	5	124121743	nonsense	probably null
R4903:Pitpnm2	UTSW	5	124152605	missense	probably damaging	1.00
R5151:Pitpnm2	UTSW	5	124136386	missense	probably damaging	1.00
R5315:Pitpnm2	UTSW	5	124121933	missense	probably benign	0.18
R5592:Pitpnm2	UTSW	5	124142149	missense	probably damaging	1.00
R5792:Pitpnm2	UTSW	5	124130321	nonsense	probably null
R6846:Pitpnm2	UTSW	5	124131171	missense	probably benign	0.00
R6983:Pitpnm2	UTSW	5	124133406	missense	probably damaging	1.00
R7096:Pitpnm2	UTSW	5	124129261	missense	possibly damaging	0.69
R7188:Pitpnm2	UTSW	5	124121303	missense	probably benign	0.31
R7203:Pitpnm2	UTSW	5	124121459	missense	probably damaging	0.96
R7237:Pitpnm2	UTSW	5	124125297	critical splice donor site	probably null
R7257:Pitpnm2	UTSW	5	124125356	missense	possibly damaging	0.88
R7622:Pitpnm2	UTSW	5	124122027	missense	probably benign	0.39
R7677:Pitpnm2	UTSW	5	124123569	missense	probably damaging	1.00
R7736:Pitpnm2	UTSW	5	124123030	missense	possibly damaging	0.47
R7745:Pitpnm2	UTSW	5	124128705	missense	probably benign	0.19

Predicted Primers

PCR Primer
(F):5'- TGGACCACTGCTTCTTCAGG -3'
(R):5'- TGTGAACTCCTGAGACCACTG -3'

Sequencing Primer
(F):5'- ACTGCTTCTTCAGGCCCCG -3'
(R):5'- GGACCCAGTTCTCTAGGTTGAC -3'

Posted On

2014-12-04