Mutagenetix > Incidental Mutation

Incidental Mutation 'R0311:Chd4'

25195

Institutional Source

Beutler Lab

Gene Symbol

Chd4

Ensembl Gene

ENSMUSG00000063870

Gene Name

chromodomain helicase DNA binding protein 4

Synonyms

D6Ertd380e, Mi-2beta, 9530019N15Rik

MMRRC Submission

038521-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0311 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

125095981-125130591 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 125101665 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 257 (I257T)

Ref Sequence

ENSEMBL: ENSMUSP00000108009 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056889] [ENSMUST00000112390] [ENSMUST00000112392] [ENSMUST00000155261]

AlphaFold

Q6PDQ2

Predicted Effect

probably benign
Transcript: ENSMUST00000056889
AA Change: I250T

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000060054
Gene: ENSMUSG00000063870
AA Change: I250T

Domain	Start	End	E-Value	Type
low complexity region	29	45	N/A	INTRINSIC
low complexity region	49	69	N/A	INTRINSIC
low complexity region	80	92	N/A	INTRINSIC
low complexity region	107	144	N/A	INTRINSIC
Pfam:CHDNT	156	210	7.7e-35	PFAM
low complexity region	217	249	N/A	INTRINSIC
low complexity region	271	291	N/A	INTRINSIC
low complexity region	296	318	N/A	INTRINSIC
low complexity region	321	347	N/A	INTRINSIC
PHD	365	408	7.17e-15	SMART
RING	366	407	7.46e-1	SMART
low complexity region	424	443	N/A	INTRINSIC
PHD	444	487	4.41e-15	SMART
RING	445	486	2.63e0	SMART
CHROMO	492	572	8.11e-17	SMART
CHROMO	613	670	1.98e-11	SMART
low complexity region	675	694	N/A	INTRINSIC
DEXDc	715	927	2.73e-37	SMART
low complexity region	1044	1056	N/A	INTRINSIC
HELICc	1073	1157	7.61e-27	SMART
DUF1087	1282	1346	5.56e-33	SMART
DUF1086	1359	1516	4.05e-108	SMART
low complexity region	1526	1540	N/A	INTRINSIC
low complexity region	1560	1578	N/A	INTRINSIC
low complexity region	1590	1633	N/A	INTRINSIC
low complexity region	1635	1653	N/A	INTRINSIC
low complexity region	1661	1674	N/A	INTRINSIC
Pfam:CHDCT2	1727	1899	1.9e-98	PFAM
low complexity region	1903	1915	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112390
AA Change: I257T

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000108009
Gene: ENSMUSG00000063870
AA Change: I257T

Domain	Start	End	E-Value	Type
low complexity region	29	45	N/A	INTRINSIC
low complexity region	49	69	N/A	INTRINSIC
low complexity region	87	99	N/A	INTRINSIC
low complexity region	114	151	N/A	INTRINSIC
Pfam:CHDNT	164	217	2e-28	PFAM
low complexity region	224	256	N/A	INTRINSIC
low complexity region	278	298	N/A	INTRINSIC
low complexity region	303	325	N/A	INTRINSIC
low complexity region	328	354	N/A	INTRINSIC
PHD	372	415	7.17e-15	SMART
RING	373	414	7.46e-1	SMART
low complexity region	431	450	N/A	INTRINSIC
PHD	451	494	4.41e-15	SMART
RING	452	493	2.63e0	SMART
CHROMO	499	579	8.11e-17	SMART
CHROMO	620	677	1.98e-11	SMART
low complexity region	682	701	N/A	INTRINSIC
DEXDc	722	934	2.73e-37	SMART
low complexity region	1051	1063	N/A	INTRINSIC
HELICc	1080	1164	7.61e-27	SMART
DUF1087	1289	1353	5.56e-33	SMART
DUF1086	1366	1523	4.05e-108	SMART
low complexity region	1533	1547	N/A	INTRINSIC
low complexity region	1567	1585	N/A	INTRINSIC
low complexity region	1597	1640	N/A	INTRINSIC
low complexity region	1642	1660	N/A	INTRINSIC
low complexity region	1668	1681	N/A	INTRINSIC
Pfam:CHDCT2	1735	1906	4.3e-90	PFAM
low complexity region	1910	1922	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112392
AA Change: I250T

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000108011
Gene: ENSMUSG00000063870
AA Change: I250T

Domain	Start	End	E-Value	Type
low complexity region	29	45	N/A	INTRINSIC
low complexity region	49	69	N/A	INTRINSIC
low complexity region	80	92	N/A	INTRINSIC
low complexity region	107	144	N/A	INTRINSIC
Pfam:CHDNT	156	210	1.1e-34	PFAM
low complexity region	217	249	N/A	INTRINSIC
low complexity region	271	291	N/A	INTRINSIC
low complexity region	296	318	N/A	INTRINSIC
low complexity region	321	347	N/A	INTRINSIC
PHD	352	395	7.17e-15	SMART
RING	353	394	7.46e-1	SMART
low complexity region	411	430	N/A	INTRINSIC
PHD	431	474	4.41e-15	SMART
RING	432	473	2.63e0	SMART
CHROMO	479	559	8.11e-17	SMART
CHROMO	600	657	1.98e-11	SMART
low complexity region	662	681	N/A	INTRINSIC
DEXDc	702	914	2.73e-37	SMART
low complexity region	1031	1043	N/A	INTRINSIC
HELICc	1060	1144	7.61e-27	SMART
DUF1087	1269	1333	5.56e-33	SMART
DUF1086	1346	1503	4.05e-108	SMART
low complexity region	1513	1527	N/A	INTRINSIC
low complexity region	1547	1565	N/A	INTRINSIC
low complexity region	1577	1620	N/A	INTRINSIC
low complexity region	1622	1640	N/A	INTRINSIC
low complexity region	1648	1661	N/A	INTRINSIC
Pfam:CHDCT2	1714	1886	2.8e-98	PFAM
low complexity region	1890	1902	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000155261

SMART Domains

Protein: ENSMUSP00000122806
Gene: ENSMUSG00000063870

Domain	Start	End	E-Value	Type
Blast:DEXDc	4	25	1e-5	BLAST
low complexity region	29	45	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155932

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183346

Meta Mutation Damage Score

0.0607

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.6%
20x: 91.6%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the SNF2/RAD54 helicase family. It represents the main component of the nucleosome remodeling and deacetylase complex and plays an important role in epigenetic transcriptional repression. Patients with dermatomyositis develop antibodies against this protein. Somatic mutations in this gene are associated with serous endometrial tumors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality between E3.5 and E4.5, absent blastocoele failure of trophectoderm function and increased apoptosis in blastocysts. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	A	C	7: 120,402,904	M1547L	probably damaging	Het
Abcb4	A	G	5: 8,934,243	K658E	probably benign	Het
Abr	A	G	11: 76,509,127	S15P	possibly damaging	Het
Adgrb2	G	C	4: 130,017,129	A1168P	probably damaging	Het
Adgre4	A	T	17: 55,802,010	E339V	probably benign	Het
Asprv1	T	C	6: 86,628,840	W223R	probably damaging	Het
Ccdc89	A	G	7: 90,426,693	E37G	probably damaging	Het
Cd48	C	A	1: 171,699,580	Y191*	probably null	Het
Clca4b	T	C	3: 144,932,496	M2V	probably benign	Het
Dnah11	A	T	12: 118,127,133	D1025E	probably benign	Het
Erich5	A	G	15: 34,472,939	*363W	probably null	Het
Etl4	A	G	2: 20,807,129	D1341G	probably damaging	Het
Fbxw11	A	G	11: 32,722,083	T184A	probably benign	Het
Fktn	A	G	4: 53,744,620	Q300R	probably benign	Het
G3bp1	T	C	11: 55,498,626	F383L	probably damaging	Het
Gdpd3	G	A	7: 126,767,189	R66Q	possibly damaging	Het
Hexb	A	G	13: 97,183,819		probably benign	Het
Kdm4b	A	G	17: 56,386,200	R346G	probably benign	Het
Mbtd1	T	A	11: 93,921,357		probably null	Het
Med23	T	A	10: 24,897,358	C653S	possibly damaging	Het
Nwd2	A	T	5: 63,804,998	I642L	probably damaging	Het
Olfr1444	A	G	19: 12,861,869	I31M	probably benign	Het
Olfr1448	T	A	19: 12,920,096	Y71F	possibly damaging	Het
Olfr912	T	C	9: 38,539,297	V134A	probably benign	Het
Pbld2	T	C	10: 63,054,507		probably null	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Pkd1l3	G	A	8: 109,623,663	S380N	probably benign	Het
Plpp2	C	T	10: 79,527,580	R77K	probably damaging	Het
Pym1	G	T	10: 128,765,984	R168L	possibly damaging	Het
Rbm4	T	C	19: 4,787,556	Y300C	probably damaging	Het
Rnf207	A	G	4: 152,315,779	C175R	probably damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Speg	T	C	1: 75,430,937	V3196A	probably damaging	Het
Syne1	T	A	10: 5,348,943	I1048L	possibly damaging	Het
Th	T	C	7: 142,896,041	E41G	probably damaging	Het
Tmx4	T	A	2: 134,598,526	*336L	probably null	Het
Tnfrsf18	T	C	4: 156,026,415	V10A	possibly damaging	Het
Tnxb	A	T	17: 34,716,984	I2670F	probably damaging	Het
Tpx2	T	C	2: 152,890,492	V562A	probably damaging	Het
Vmn2r73	A	G	7: 85,871,789	S324P	probably benign	Het
Vps18	T	C	2: 119,297,365	Y890H	probably benign	Het
Ythdc1	G	A	5: 86,835,705	D670N	probably damaging	Het

Other mutations in Chd4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00573:Chd4	APN	6	125109897	missense	probably damaging	1.00
IGL00917:Chd4	APN	6	125104946	missense	possibly damaging	0.95
IGL01088:Chd4	APN	6	125122468	unclassified	probably benign
IGL02005:Chd4	APN	6	125128816	missense	possibly damaging	0.71
IGL02405:Chd4	APN	6	125097227	missense	probably benign	0.06
IGL02707:Chd4	APN	6	125108767	missense	probably damaging	1.00
IGL02976:Chd4	APN	6	125121368	missense	probably damaging	1.00
IGL03001:Chd4	APN	6	125101566	missense	possibly damaging	0.93
FR4304:Chd4	UTSW	6	125122144	unclassified	probably benign
FR4589:Chd4	UTSW	6	125122133	missense	probably benign	0.02
FR4589:Chd4	UTSW	6	125122139	unclassified	probably benign
FR4737:Chd4	UTSW	6	125122131	unclassified	probably benign
FR4976:Chd4	UTSW	6	125122131	unclassified	probably benign
R0414:Chd4	UTSW	6	125107480	missense	probably damaging	1.00
R0647:Chd4	UTSW	6	125109123	missense	probably damaging	1.00
R0656:Chd4	UTSW	6	125102967	missense	probably damaging	0.98
R1342:Chd4	UTSW	6	125097188	missense	probably benign	0.40
R1651:Chd4	UTSW	6	125123584	missense	possibly damaging	0.92
R1850:Chd4	UTSW	6	125121656	missense	probably damaging	1.00
R2190:Chd4	UTSW	6	125114297	missense	probably benign	0.18
R2192:Chd4	UTSW	6	125105357	missense	probably damaging	0.99
R2858:Chd4	UTSW	6	125104886	missense	probably damaging	0.99
R3406:Chd4	UTSW	6	125122007	missense	probably benign	0.09
R3431:Chd4	UTSW	6	125120560	splice site	probably benign
R4330:Chd4	UTSW	6	125101602	missense	probably benign	0.29
R4394:Chd4	UTSW	6	125121618	missense	probably damaging	0.99
R4538:Chd4	UTSW	6	125120686	missense	probably damaging	0.99
R4664:Chd4	UTSW	6	125101502	missense	possibly damaging	0.58
R4805:Chd4	UTSW	6	125128945	missense	possibly damaging	0.86
R5050:Chd4	UTSW	6	125107480	missense	probably damaging	1.00
R5055:Chd4	UTSW	6	125100986	missense	possibly damaging	0.65
R5232:Chd4	UTSW	6	125121310	missense	probably damaging	1.00
R5314:Chd4	UTSW	6	125100588	missense	probably damaging	0.96
R5343:Chd4	UTSW	6	125120363	missense	probably damaging	1.00
R5502:Chd4	UTSW	6	125105276	missense	possibly damaging	0.83
R5613:Chd4	UTSW	6	125120546	missense	probably damaging	0.99
R6211:Chd4	UTSW	6	125101285	missense	possibly damaging	0.82
R6606:Chd4	UTSW	6	125109426	missense	probably damaging	0.99
R6753:Chd4	UTSW	6	125114300	missense	probably benign	0.01
R6808:Chd4	UTSW	6	125122123	missense	possibly damaging	0.53
R6939:Chd4	UTSW	6	125106538	missense	probably damaging	0.99
R6968:Chd4	UTSW	6	125108318	missense	probably damaging	1.00
R6973:Chd4	UTSW	6	125122862	missense	possibly damaging	0.53
R6992:Chd4	UTSW	6	125114376	missense	probably benign	0.14
R7058:Chd4	UTSW	6	125108442	missense	possibly damaging	0.74
R7081:Chd4	UTSW	6	125129985	missense	unknown
R7253:Chd4	UTSW	6	125106592	splice site	probably null
R7423:Chd4	UTSW	6	125128859	missense	possibly damaging	0.92
R7535:Chd4	UTSW	6	125128873	missense	probably benign	0.32
R7566:Chd4	UTSW	6	125101903	missense	possibly damaging	0.86
R8053:Chd4	UTSW	6	125128816	nonsense	probably null
R8155:Chd4	UTSW	6	125105324	missense	probably benign	0.00
R8711:Chd4	UTSW	6	125123522	unclassified	probably benign
R8783:Chd4	UTSW	6	125123384	missense	possibly damaging	0.53
R9020:Chd4	UTSW	6	125107506	missense	probably damaging	1.00
R9093:Chd4	UTSW	6	125114011	missense	probably benign	0.13
R9417:Chd4	UTSW	6	125120725	missense	probably damaging	0.99
R9509:Chd4	UTSW	6	125122522	missense	possibly damaging	0.96
RF046:Chd4	UTSW	6	125122131	unclassified	probably benign
RF052:Chd4	UTSW	6	125122145	unclassified	probably benign
RF058:Chd4	UTSW	6	125122131	unclassified	probably benign
RF060:Chd4	UTSW	6	125122145	unclassified	probably benign
X0025:Chd4	UTSW	6	125106467	nonsense	probably null
X0027:Chd4	UTSW	6	125102164	missense	probably damaging	0.98
X0063:Chd4	UTSW	6	125114015	missense	probably damaging	1.00
Z1176:Chd4	UTSW	6	125100860	missense	possibly damaging	0.93
Z1176:Chd4	UTSW	6	125101598	missense	probably benign	0.36

Predicted Primers

PCR Primer
(F):5'- AACCCCAAGATTGCTGTCTCCAAG -3'
(R):5'- TTCCTCCGAGCATTGGGACCTAAG -3'

Sequencing Primer
(F):5'- CAAGATTGCTGTCTCCAAGATGATG -3'
(R):5'- CATTGGGACCTAAGATCAGGATAC -3'

Posted On

2013-04-16