Incidental Mutation 'R2849:Zfp607b'
ID251953
Institutional Source Beutler Lab
Gene Symbol Zfp607b
Ensembl Gene ENSMUSG00000057093
Gene Namezinc finger protein 607B
SynonymsC030039L03Rik
MMRRC Submission 040442-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R2849 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location27689340-27706484 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 27702394 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 92 (V92I)
Ref Sequence ENSEMBL: ENSMUSP00000112494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076421] [ENSMUST00000120004]
Predicted Effect probably benign
Transcript: ENSMUST00000076421
AA Change: V92I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075755
Gene: ENSMUSG00000057093
AA Change: V92I

DomainStartEndE-ValueType
KRAB 14 75 1.29e-35 SMART
ZnF_C2H2 172 194 1.08e-1 SMART
ZnF_C2H2 200 222 4.24e-4 SMART
ZnF_C2H2 228 250 2.2e-2 SMART
ZnF_C2H2 256 278 1.69e-3 SMART
ZnF_C2H2 284 306 4.94e-5 SMART
ZnF_C2H2 312 334 2.36e-2 SMART
ZnF_C2H2 339 361 1.18e-2 SMART
ZnF_C2H2 367 389 1.67e-2 SMART
ZnF_C2H2 395 417 1.38e-3 SMART
ZnF_C2H2 423 445 1.06e-4 SMART
ZnF_C2H2 451 473 1.67e-2 SMART
ZnF_C2H2 479 501 6.67e-2 SMART
ZnF_C2H2 507 529 3.52e-1 SMART
ZnF_C2H2 535 557 3.49e-5 SMART
ZnF_C2H2 563 585 1.56e-2 SMART
ZnF_C2H2 591 613 3.89e-3 SMART
ZnF_C2H2 619 641 9.73e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120004
AA Change: V92I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112494
Gene: ENSMUSG00000057093
AA Change: V92I

DomainStartEndE-ValueType
KRAB 14 75 1.29e-35 SMART
ZnF_C2H2 172 194 1.08e-1 SMART
ZnF_C2H2 200 222 4.24e-4 SMART
ZnF_C2H2 228 250 2.2e-2 SMART
ZnF_C2H2 256 278 1.69e-3 SMART
ZnF_C2H2 284 306 4.94e-5 SMART
ZnF_C2H2 312 334 2.36e-2 SMART
ZnF_C2H2 339 361 1.18e-2 SMART
ZnF_C2H2 367 389 1.67e-2 SMART
ZnF_C2H2 395 417 1.38e-3 SMART
ZnF_C2H2 423 445 1.06e-4 SMART
ZnF_C2H2 451 473 1.67e-2 SMART
ZnF_C2H2 479 501 6.67e-2 SMART
ZnF_C2H2 507 529 3.52e-1 SMART
ZnF_C2H2 535 557 3.49e-5 SMART
ZnF_C2H2 563 585 1.56e-2 SMART
ZnF_C2H2 591 613 3.89e-3 SMART
ZnF_C2H2 619 641 9.73e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124397
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G C 17: 24,289,507 T1018R probably damaging Het
Abca8a T C 11: 110,042,105 D1231G probably damaging Het
Adcy7 A G 8: 88,327,393 I1017V probably benign Het
Agpat2 A G 2: 26,597,239 I109T probably damaging Het
Aldh9a1 G A 1: 167,352,628 R97H probably damaging Het
Als2 G A 1: 59,206,538 T593M probably damaging Het
Ap3d1 G C 10: 80,741,908 H28Q possibly damaging Het
Atxn1 A T 13: 45,566,699 D573E probably damaging Het
BC100530 T A 16: 36,367,452 Q17L probably damaging Het
Begain T A 12: 109,033,118 M576L probably benign Het
Bod1l T C 5: 41,838,076 N109S probably damaging Het
Boll A G 1: 55,346,373 M131T possibly damaging Het
Celf2 T C 2: 6,604,125 R282G probably damaging Het
Cers2 T C 3: 95,322,459 F330L probably benign Het
Chst13 T C 6: 90,309,158 D274G probably benign Het
Dclk2 A G 3: 86,793,223 V649A probably damaging Het
Deaf1 T C 7: 141,314,454 *54W probably null Het
Fbf1 C T 11: 116,157,688 probably null Het
Fbxo32 C T 15: 58,207,972 S71N probably benign Het
Fbxo42 T A 4: 141,200,510 N700K probably damaging Het
Fis1 T C 5: 136,963,117 I55T possibly damaging Het
Fyco1 A T 9: 123,834,826 L121* probably null Het
Gm2381 G A 7: 42,820,407 P98S probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Gtf2ird1 G A 5: 134,359,007 T946I probably damaging Het
Hmcn1 G T 1: 150,563,599 Y5494* probably null Het
Josd2 A G 7: 44,468,973 probably null Het
Lfng T A 5: 140,611,867 D149E probably damaging Het
Lrp1 C T 10: 127,542,296 A4052T probably damaging Het
Lrrtm3 T C 10: 64,089,031 N119S probably damaging Het
Lypd6 C T 2: 50,165,652 P38L probably damaging Het
Msl3l2 T C 10: 56,115,442 C88R probably benign Het
Nsd1 A G 13: 55,213,692 T158A probably damaging Het
Nudt22 A T 19: 6,993,484 S239R probably benign Het
Odf3 A G 7: 140,849,269 T156A probably benign Het
Olfr1288 T C 2: 111,479,354 M190T probably benign Het
Olfr584 A T 7: 103,086,112 D193V probably damaging Het
Osbpl8 T A 10: 111,269,436 S251T probably benign Het
Otop3 T C 11: 115,344,558 F339L probably damaging Het
Pcdhga10 T A 18: 37,748,200 V338E possibly damaging Het
Pcnx2 A G 8: 125,760,927 F1779S probably damaging Het
Plxna4 T C 6: 32,185,532 K1349E probably damaging Het
Poteg A T 8: 27,481,676 N406I probably benign Het
Ppp4r4 T C 12: 103,606,933 V697A probably benign Het
Ptpra C A 2: 130,544,999 H603Q probably benign Het
Rnf10 T C 5: 115,249,112 D439G probably benign Het
Rnf43 T A 11: 87,732,267 N731K probably benign Het
Slc2a4 T A 11: 69,946,171 N116Y probably damaging Het
Slc6a15 C A 10: 103,404,691 H392N probably benign Het
Slco6d1 C T 1: 98,466,716 T375I probably benign Het
Smpd4 A G 16: 17,642,212 D436G probably damaging Het
Spata22 G A 11: 73,353,745 W311* probably null Het
Syt3 G A 7: 44,393,442 V383I probably benign Het
Tle6 T A 10: 81,594,401 I306F probably damaging Het
Tox3 G A 8: 90,248,390 Q538* probably null Het
Trim24 T A 6: 37,956,453 S656T probably damaging Het
Trnau1ap C A 4: 132,321,734 V119F possibly damaging Het
Vmn1r181 G T 7: 23,984,518 S136I possibly damaging Het
Vmn1r82 T C 7: 12,305,406 V202A probably damaging Het
Zfp964 G C 8: 69,663,854 C368S unknown Het
Zw10 A G 9: 49,057,641 probably null Het
Other mutations in Zfp607b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02090:Zfp607b APN 7 27698715 missense possibly damaging 0.75
IGL02114:Zfp607b APN 7 27703725 missense probably benign 0.19
IGL03171:Zfp607b APN 7 27693595 missense possibly damaging 0.70
IGL03329:Zfp607b APN 7 27703870 missense probably damaging 1.00
R0988:Zfp607b UTSW 7 27702976 missense probably benign 0.34
R1518:Zfp607b UTSW 7 27698662 missense possibly damaging 0.95
R1672:Zfp607b UTSW 7 27692523 missense possibly damaging 0.86
R1733:Zfp607b UTSW 7 27692524 missense possibly damaging 0.66
R1992:Zfp607b UTSW 7 27702524 missense possibly damaging 0.87
R3879:Zfp607b UTSW 7 27704051 missense possibly damaging 0.91
R4117:Zfp607b UTSW 7 27698682 missense probably damaging 0.97
R4439:Zfp607b UTSW 7 27702724 missense probably damaging 1.00
R4610:Zfp607b UTSW 7 27703695 missense probably damaging 1.00
R4755:Zfp607b UTSW 7 27703505 missense probably damaging 1.00
R4909:Zfp607b UTSW 7 27703796 missense probably benign
R5095:Zfp607b UTSW 7 27693636 intron probably benign
R5301:Zfp607b UTSW 7 27703747 missense probably benign
R5422:Zfp607b UTSW 7 27702388 missense probably benign 0.00
R5538:Zfp607b UTSW 7 27702869 missense probably damaging 1.00
R5546:Zfp607b UTSW 7 27702607 missense probably benign 0.19
R5644:Zfp607b UTSW 7 27703769 missense probably damaging 1.00
R5649:Zfp607b UTSW 7 27703981 missense probably damaging 1.00
R5692:Zfp607b UTSW 7 27703464 missense probably benign 0.17
R5945:Zfp607b UTSW 7 27702416 missense probably benign 0.06
R6695:Zfp607b UTSW 7 27704039 missense probably benign 0.04
R7402:Zfp607b UTSW 7 27693494 missense probably damaging 1.00
R7515:Zfp607b UTSW 7 27703496 missense probably benign 0.03
Z1177:Zfp607b UTSW 7 27702394 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAACCTGTTCTACGGTAAAGCG -3'
(R):5'- AGCAAGAGTCTGGCAGGTAC -3'

Sequencing Primer
(F):5'- CCTGTTCTACGGTAAAGCGTATTATC -3'
(R):5'- TCTGGCAGGTACAAGGAGGC -3'
Posted On2014-12-04