Incidental Mutation 'R2510:Klk1b1'
ID251956
Institutional Source Beutler Lab
Gene Symbol Klk1b1
Ensembl Gene ENSMUSG00000063133
Gene Namekallikrein 1-related peptidase b1
SynonymsmGK-1, tissue kallikrein, TK, Klk1, mK1
MMRRC Submission 040416-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R2510 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location43966751-43971318 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43969379 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 60 (V60A)
Ref Sequence ENSEMBL: ENSMUSP00000077879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078835]
Predicted Effect probably damaging
Transcript: ENSMUST00000078835
AA Change: V60A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077879
Gene: ENSMUSG00000063133
AA Change: V60A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 1.25e-98 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206172
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206796
Meta Mutation Damage Score 0.8585 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous null mice display decreased left ventricular contractility, cardiac output, and stroke volume, a thin left ventricular wall, and impaired vasodilation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,625,300 M506V probably benign Het
4930571K23Rik C A 7: 125,369,139 noncoding transcript Het
Adra1d C A 2: 131,562,135 E12* probably null Het
Ago4 A T 4: 126,517,071 D208E probably damaging Het
Agrn A T 4: 156,166,424 probably null Het
Atxn2 C T 5: 121,781,393 S388L probably damaging Het
Bbox1 A T 2: 110,305,631 M1K probably null Het
Btaf1 G A 19: 37,002,445 R1538H probably benign Het
Car11 G A 7: 45,701,359 G93E probably damaging Het
Col18a1 A G 10: 77,096,268 L329P unknown Het
Copb2 T A 9: 98,571,648 probably benign Het
Dnah2 G T 11: 69,524,206 S234* probably null Het
Dnah9 T C 11: 66,005,169 Y2460C probably damaging Het
Dnaic2 G C 11: 114,757,167 probably benign Het
Dst C A 1: 34,212,286 T1814K probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fancm A T 12: 65,113,770 probably benign Het
Fsip2 T C 2: 82,986,438 S4172P probably benign Het
G530012D18Rik T G 1: 85,577,204 probably benign Het
Gca T G 2: 62,689,974 S159R probably damaging Het
Gja8 T G 3: 96,919,717 T210P probably damaging Het
Gm10639 T A 9: 78,294,807 M1K probably null Het
Gm13103 G A 4: 143,851,991 V274I probably benign Het
Gm5117 T A 8: 31,738,355 noncoding transcript Het
Gm5900 T A 7: 104,950,364 noncoding transcript Het
Gpi1 A G 7: 34,205,923 S359P probably damaging Het
Grm5 A G 7: 88,036,091 E472G probably benign Het
Hoxd12 G A 2: 74,675,471 A129T possibly damaging Het
Ifnlr1 G T 4: 135,705,248 D332Y probably damaging Het
Ift140 T C 17: 25,036,308 I466T probably benign Het
Kansl2 A G 15: 98,528,861 probably null Het
Kat2a T C 11: 100,712,142 Q88R probably benign Het
Kcnh7 T C 2: 62,721,917 D910G probably benign Het
Krt7 A C 15: 101,412,657 I62L probably benign Het
Llgl1 A G 11: 60,710,036 K653E probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mafb T G 2: 160,366,576 E34A probably damaging Het
Meiob T C 17: 24,816,597 probably benign Het
Mllt10 C A 2: 18,065,124 D30E possibly damaging Het
Mprip T A 11: 59,749,508 probably benign Het
Muc5b A T 7: 141,859,061 N1915Y unknown Het
Mycbp2 C T 14: 103,155,255 R3290Q probably damaging Het
Obscn G A 11: 59,042,314 probably benign Het
Olfm3 T A 3: 115,122,310 V277D probably damaging Het
Olfr1271 C T 2: 90,265,606 V275I probably damaging Het
Olfr1286 G A 2: 111,420,451 P167S possibly damaging Het
Olfr668 G A 7: 104,925,687 H26Y probably benign Het
Olfr960 T A 9: 39,623,431 F101I probably damaging Het
Omp A T 7: 98,145,345 M25K possibly damaging Het
Otoa C T 7: 121,160,472 T1099I probably benign Het
Pcdh15 T G 10: 74,631,499 S1715A probably benign Het
Pcnx4 T C 12: 72,566,972 W564R probably damaging Het
Pde12 T C 14: 26,665,526 *609W probably null Het
Pitpnm2 T C 5: 124,136,326 E240G probably damaging Het
Plppr4 G T 3: 117,331,706 N161K probably damaging Het
Ppp1r37 T C 7: 19,532,432 K470E possibly damaging Het
Ptprd C A 4: 76,086,011 probably null Het
Rgs9 T C 11: 109,268,972 Y178C probably benign Het
Rims2 T G 15: 39,585,652 S1217R probably damaging Het
Rorc C T 3: 94,389,120 T208I probably benign Het
Ryr3 C T 2: 112,675,904 E3458K probably benign Het
Scn5a A T 9: 119,533,685 V623E probably benign Het
Slc28a2 C T 2: 122,451,016 Q229* probably null Het
Slc35f3 C T 8: 126,298,706 probably benign Het
Spg11 T G 2: 122,075,310 I1285L probably benign Het
Sstr2 A T 11: 113,624,923 I223F probably damaging Het
Susd1 A T 4: 59,349,855 V527E possibly damaging Het
Tas1r2 A G 4: 139,659,851 N207S probably damaging Het
Tmem57 A G 4: 134,804,388 S657P probably damaging Het
Trappc10 A G 10: 78,211,523 S380P possibly damaging Het
Ttn T C 2: 76,740,992 D26519G probably damaging Het
Vmn1r215 A G 13: 23,076,173 I128V probably benign Het
Vmn1r37 T C 6: 66,731,951 L150P probably damaging Het
Vmn2r52 G T 7: 10,170,868 A348E probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Wdyhv1 C A 15: 58,153,624 A145D probably damaging Het
Ypel5 T C 17: 72,846,391 L30P probably damaging Het
Zfp985 A G 4: 147,582,986 T104A possibly damaging Het
Other mutations in Klk1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Klk1b1 APN 7 43971169 missense possibly damaging 0.83
IGL02794:Klk1b1 APN 7 43970365 missense possibly damaging 0.62
IGL03266:Klk1b1 APN 7 43970476 missense probably benign 0.18
R0324:Klk1b1 UTSW 7 43970741 nonsense probably null
R0689:Klk1b1 UTSW 7 43970719 missense probably benign
R1552:Klk1b1 UTSW 7 43969343 missense probably damaging 1.00
R1697:Klk1b1 UTSW 7 43970326 missense probably benign 0.01
R1737:Klk1b1 UTSW 7 43970359 missense probably benign 0.01
R2060:Klk1b1 UTSW 7 43970623 missense possibly damaging 0.73
R2159:Klk1b1 UTSW 7 43970433 missense probably damaging 0.97
R2177:Klk1b1 UTSW 7 43969271 missense possibly damaging 0.63
R2213:Klk1b1 UTSW 7 43970481 missense probably damaging 1.00
R2509:Klk1b1 UTSW 7 43969379 missense probably damaging 1.00
R3849:Klk1b1 UTSW 7 43969327 missense probably damaging 1.00
R5567:Klk1b1 UTSW 7 43971169 missense probably damaging 0.99
R6191:Klk1b1 UTSW 7 43970657 missense probably damaging 1.00
R7162:Klk1b1 UTSW 7 43969247 missense probably damaging 0.99
R7535:Klk1b1 UTSW 7 43970322 missense probably damaging 1.00
X0012:Klk1b1 UTSW 7 43970659 missense probably benign 0.05
Z1088:Klk1b1 UTSW 7 43970401 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAACCCTGTCCTGCTTAAC -3'
(R):5'- AGTACTCTGAACCCAAGGCTG -3'

Sequencing Primer
(F):5'- AAGTGCACCTCCCTACATGTG -3'
(R):5'- CCAAGGCTGGGATGGAGG -3'
Posted On2014-12-04