Incidental Mutation 'R2849:Osbpl8'
ID251993
Institutional Source Beutler Lab
Gene Symbol Osbpl8
Ensembl Gene ENSMUSG00000020189
Gene Nameoxysterol binding protein-like 8
SynonymsD330025H14Rik, ORP-8
MMRRC Submission 040442-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R2849 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location111164752-111297249 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111269436 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 251 (S251T)
Ref Sequence ENSEMBL: ENSMUSP00000100911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095310] [ENSMUST00000105275]
Predicted Effect probably benign
Transcript: ENSMUST00000095310
AA Change: S209T

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000092948
Gene: ENSMUSG00000020189
AA Change: S209T

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
coiled coil region 71 102 N/A INTRINSIC
PH 107 225 3.65e-16 SMART
Pfam:Oxysterol_BP 364 715 6.4e-91 PFAM
coiled coil region 789 811 N/A INTRINSIC
transmembrane domain 829 846 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105275
AA Change: S251T

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000100911
Gene: ENSMUSG00000020189
AA Change: S251T

DomainStartEndE-ValueType
low complexity region 85 101 N/A INTRINSIC
coiled coil region 113 144 N/A INTRINSIC
PH 149 267 3.65e-16 SMART
Pfam:Oxysterol_BP 406 752 4.6e-91 PFAM
coiled coil region 831 853 N/A INTRINSIC
transmembrane domain 871 888 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220139
Meta Mutation Damage Score 0.1661 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the oxysterol-binding protein (Osbp) family, a group of intracellular lipid receptors. Like most members, the encoded protein contains an N-terminal pleckstrin homology domain and a highly conserved C-terminal Osbp-like sterol-binding domain. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit elevated of HDL and gender-specific alterations in lipid metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G C 17: 24,289,507 T1018R probably damaging Het
Abca8a T C 11: 110,042,105 D1231G probably damaging Het
Adcy7 A G 8: 88,327,393 I1017V probably benign Het
Agpat2 A G 2: 26,597,239 I109T probably damaging Het
Aldh9a1 G A 1: 167,352,628 R97H probably damaging Het
Als2 G A 1: 59,206,538 T593M probably damaging Het
Ap3d1 G C 10: 80,741,908 H28Q possibly damaging Het
Atxn1 A T 13: 45,566,699 D573E probably damaging Het
BC100530 T A 16: 36,367,452 Q17L probably damaging Het
Begain T A 12: 109,033,118 M576L probably benign Het
Bod1l T C 5: 41,838,076 N109S probably damaging Het
Boll A G 1: 55,346,373 M131T possibly damaging Het
Celf2 T C 2: 6,604,125 R282G probably damaging Het
Cers2 T C 3: 95,322,459 F330L probably benign Het
Chst13 T C 6: 90,309,158 D274G probably benign Het
Dclk2 A G 3: 86,793,223 V649A probably damaging Het
Deaf1 T C 7: 141,314,454 *54W probably null Het
Fbf1 C T 11: 116,157,688 probably null Het
Fbxo32 C T 15: 58,207,972 S71N probably benign Het
Fbxo42 T A 4: 141,200,510 N700K probably damaging Het
Fis1 T C 5: 136,963,117 I55T possibly damaging Het
Fyco1 A T 9: 123,834,826 L121* probably null Het
Gm2381 G A 7: 42,820,407 P98S probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Gtf2ird1 G A 5: 134,359,007 T946I probably damaging Het
Hmcn1 G T 1: 150,563,599 Y5494* probably null Het
Josd2 A G 7: 44,468,973 probably null Het
Lfng T A 5: 140,611,867 D149E probably damaging Het
Lrp1 C T 10: 127,542,296 A4052T probably damaging Het
Lrrtm3 T C 10: 64,089,031 N119S probably damaging Het
Lypd6 C T 2: 50,165,652 P38L probably damaging Het
Msl3l2 T C 10: 56,115,442 C88R probably benign Het
Nsd1 A G 13: 55,213,692 T158A probably damaging Het
Nudt22 A T 19: 6,993,484 S239R probably benign Het
Odf3 A G 7: 140,849,269 T156A probably benign Het
Olfr1288 T C 2: 111,479,354 M190T probably benign Het
Olfr584 A T 7: 103,086,112 D193V probably damaging Het
Otop3 T C 11: 115,344,558 F339L probably damaging Het
Pcdhga10 T A 18: 37,748,200 V338E possibly damaging Het
Pcnx2 A G 8: 125,760,927 F1779S probably damaging Het
Plxna4 T C 6: 32,185,532 K1349E probably damaging Het
Poteg A T 8: 27,481,676 N406I probably benign Het
Ppp4r4 T C 12: 103,606,933 V697A probably benign Het
Ptpra C A 2: 130,544,999 H603Q probably benign Het
Rnf10 T C 5: 115,249,112 D439G probably benign Het
Rnf43 T A 11: 87,732,267 N731K probably benign Het
Slc2a4 T A 11: 69,946,171 N116Y probably damaging Het
Slc6a15 C A 10: 103,404,691 H392N probably benign Het
Slco6d1 C T 1: 98,466,716 T375I probably benign Het
Smpd4 A G 16: 17,642,212 D436G probably damaging Het
Spata22 G A 11: 73,353,745 W311* probably null Het
Syt3 G A 7: 44,393,442 V383I probably benign Het
Tle6 T A 10: 81,594,401 I306F probably damaging Het
Tox3 G A 8: 90,248,390 Q538* probably null Het
Trim24 T A 6: 37,956,453 S656T probably damaging Het
Trnau1ap C A 4: 132,321,734 V119F possibly damaging Het
Vmn1r181 G T 7: 23,984,518 S136I possibly damaging Het
Vmn1r82 T C 7: 12,305,406 V202A probably damaging Het
Zfp607b G A 7: 27,702,394 V92I probably benign Het
Zfp964 G C 8: 69,663,854 C368S unknown Het
Zw10 A G 9: 49,057,641 probably null Het
Other mutations in Osbpl8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Osbpl8 APN 10 111273044 missense probably benign 0.30
IGL00826:Osbpl8 APN 10 111272320 splice site probably benign
IGL00839:Osbpl8 APN 10 111291510 missense probably benign 0.01
IGL01148:Osbpl8 APN 10 111276563 splice site probably benign
IGL01338:Osbpl8 APN 10 111267747 missense probably damaging 0.99
IGL01927:Osbpl8 APN 10 111270616 missense probably benign 0.00
IGL02378:Osbpl8 APN 10 111282145 missense possibly damaging 0.94
IGL02863:Osbpl8 APN 10 111284425 splice site probably benign
IGL02933:Osbpl8 APN 10 111282130 missense probably damaging 1.00
IGL03075:Osbpl8 APN 10 111291556 missense probably benign 0.01
R0388:Osbpl8 UTSW 10 111272282 missense probably benign
R0725:Osbpl8 UTSW 10 111286240 missense possibly damaging 0.64
R1353:Osbpl8 UTSW 10 111276479 missense probably damaging 0.97
R1434:Osbpl8 UTSW 10 111291581 missense probably benign 0.01
R1803:Osbpl8 UTSW 10 111275049 missense probably damaging 1.00
R1939:Osbpl8 UTSW 10 111289811 missense probably benign 0.19
R2847:Osbpl8 UTSW 10 111269436 missense probably benign 0.27
R2848:Osbpl8 UTSW 10 111269436 missense probably benign 0.27
R2879:Osbpl8 UTSW 10 111269436 missense probably benign 0.27
R2935:Osbpl8 UTSW 10 111269436 missense probably benign 0.27
R3693:Osbpl8 UTSW 10 111269436 missense probably benign 0.27
R4088:Osbpl8 UTSW 10 111289790 missense possibly damaging 0.52
R4374:Osbpl8 UTSW 10 111269419 missense possibly damaging 0.93
R4376:Osbpl8 UTSW 10 111269419 missense possibly damaging 0.93
R4377:Osbpl8 UTSW 10 111269419 missense possibly damaging 0.93
R4621:Osbpl8 UTSW 10 111269418 missense probably benign 0.01
R4622:Osbpl8 UTSW 10 111291496 missense probably benign 0.00
R4851:Osbpl8 UTSW 10 111204800 start codon destroyed probably null 0.00
R5134:Osbpl8 UTSW 10 111288693 missense probably benign 0.28
R5179:Osbpl8 UTSW 10 111272164 missense probably benign 0.01
R5309:Osbpl8 UTSW 10 111270557 missense probably benign 0.00
R5590:Osbpl8 UTSW 10 111272168 missense probably damaging 0.98
R5783:Osbpl8 UTSW 10 111267783 nonsense probably null
R6293:Osbpl8 UTSW 10 111272238 missense possibly damaging 0.96
R6362:Osbpl8 UTSW 10 111273068 nonsense probably null
R6527:Osbpl8 UTSW 10 111293205 missense probably benign 0.23
R6751:Osbpl8 UTSW 10 111275013 missense possibly damaging 0.67
R6851:Osbpl8 UTSW 10 111270618 nonsense probably null
R6955:Osbpl8 UTSW 10 111269444 critical splice donor site probably null
R7224:Osbpl8 UTSW 10 111275011 missense possibly damaging 0.94
R7235:Osbpl8 UTSW 10 111269427 missense probably benign
R7685:Osbpl8 UTSW 10 111276509 nonsense probably null
R8055:Osbpl8 UTSW 10 111284394 missense possibly damaging 0.68
RF007:Osbpl8 UTSW 10 111276467 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGTGCCTGATGAATCCATATCTG -3'
(R):5'- AAGCATTCATGTGTCAGTGGAG -3'

Sequencing Primer
(F):5'- GCCTGATGAATCCATATCTGATAAG -3'
(R):5'- TGCACTGTTAACACGGCC -3'
Posted On2014-12-04