Incidental Mutation 'R2849:Abca8a'
ID252005
Institutional Source Beutler Lab
Gene Symbol Abca8a
Ensembl Gene ENSMUSG00000041828
Gene NameATP-binding cassette, sub-family A (ABC1), member 8a
Synonyms
MMRRC Submission 040442-MU
Accession Numbers

Genbank: NM_153145

Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R2849 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location110025634-110095978 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110042105 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1231 (D1231G)
Ref Sequence ENSEMBL: ENSMUSP00000102275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046223] [ENSMUST00000100287] [ENSMUST00000106664]
Predicted Effect probably damaging
Transcript: ENSMUST00000046223
AA Change: D1230G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045808
Gene: ENSMUSG00000041828
AA Change: D1230G

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 27 416 8e-26 PFAM
AAA 505 689 6.27e-9 SMART
Pfam:ABC2_membrane_3 860 1174 6.8e-15 PFAM
transmembrane domain 1196 1218 N/A INTRINSIC
low complexity region 1246 1255 N/A INTRINSIC
low complexity region 1288 1301 N/A INTRINSIC
AAA 1313 1493 4.3e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100287
AA Change: D1231G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097860
Gene: ENSMUSG00000041828
AA Change: D1231G

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 27 416 3.9e-26 PFAM
AAA 506 690 6.27e-9 SMART
Pfam:ABC2_membrane_3 861 1175 3.3e-15 PFAM
transmembrane domain 1197 1219 N/A INTRINSIC
low complexity region 1247 1256 N/A INTRINSIC
low complexity region 1289 1302 N/A INTRINSIC
AAA 1314 1494 4.3e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106664
AA Change: D1231G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102275
Gene: ENSMUSG00000041828
AA Change: D1231G

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 416 1.7e-23 PFAM
AAA 506 690 6.27e-9 SMART
Pfam:ABC2_membrane_3 861 1214 1.3e-12 PFAM
low complexity region 1247 1256 N/A INTRINSIC
low complexity region 1289 1302 N/A INTRINSIC
AAA 1314 1494 4.3e-7 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G C 17: 24,289,507 T1018R probably damaging Het
Adcy7 A G 8: 88,327,393 I1017V probably benign Het
Agpat2 A G 2: 26,597,239 I109T probably damaging Het
Aldh9a1 G A 1: 167,352,628 R97H probably damaging Het
Als2 G A 1: 59,206,538 T593M probably damaging Het
Ap3d1 G C 10: 80,741,908 H28Q possibly damaging Het
Atxn1 A T 13: 45,566,699 D573E probably damaging Het
BC100530 T A 16: 36,367,452 Q17L probably damaging Het
Begain T A 12: 109,033,118 M576L probably benign Het
Bod1l T C 5: 41,838,076 N109S probably damaging Het
Boll A G 1: 55,346,373 M131T possibly damaging Het
Celf2 T C 2: 6,604,125 R282G probably damaging Het
Cers2 T C 3: 95,322,459 F330L probably benign Het
Chst13 T C 6: 90,309,158 D274G probably benign Het
Dclk2 A G 3: 86,793,223 V649A probably damaging Het
Deaf1 T C 7: 141,314,454 *54W probably null Het
Fbf1 C T 11: 116,157,688 probably null Het
Fbxo32 C T 15: 58,207,972 S71N probably benign Het
Fbxo42 T A 4: 141,200,510 N700K probably damaging Het
Fis1 T C 5: 136,963,117 I55T possibly damaging Het
Fyco1 A T 9: 123,834,826 L121* probably null Het
Gm2381 G A 7: 42,820,407 P98S probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Gtf2ird1 G A 5: 134,359,007 T946I probably damaging Het
Hmcn1 G T 1: 150,563,599 Y5494* probably null Het
Josd2 A G 7: 44,468,973 probably null Het
Lfng T A 5: 140,611,867 D149E probably damaging Het
Lrp1 C T 10: 127,542,296 A4052T probably damaging Het
Lrrtm3 T C 10: 64,089,031 N119S probably damaging Het
Lypd6 C T 2: 50,165,652 P38L probably damaging Het
Msl3l2 T C 10: 56,115,442 C88R probably benign Het
Nsd1 A G 13: 55,213,692 T158A probably damaging Het
Nudt22 A T 19: 6,993,484 S239R probably benign Het
Odf3 A G 7: 140,849,269 T156A probably benign Het
Olfr1288 T C 2: 111,479,354 M190T probably benign Het
Olfr584 A T 7: 103,086,112 D193V probably damaging Het
Osbpl8 T A 10: 111,269,436 S251T probably benign Het
Otop3 T C 11: 115,344,558 F339L probably damaging Het
Pcdhga10 T A 18: 37,748,200 V338E possibly damaging Het
Pcnx2 A G 8: 125,760,927 F1779S probably damaging Het
Plxna4 T C 6: 32,185,532 K1349E probably damaging Het
Poteg A T 8: 27,481,676 N406I probably benign Het
Ppp4r4 T C 12: 103,606,933 V697A probably benign Het
Ptpra C A 2: 130,544,999 H603Q probably benign Het
Rnf10 T C 5: 115,249,112 D439G probably benign Het
Rnf43 T A 11: 87,732,267 N731K probably benign Het
Slc2a4 T A 11: 69,946,171 N116Y probably damaging Het
Slc6a15 C A 10: 103,404,691 H392N probably benign Het
Slco6d1 C T 1: 98,466,716 T375I probably benign Het
Smpd4 A G 16: 17,642,212 D436G probably damaging Het
Spata22 G A 11: 73,353,745 W311* probably null Het
Syt3 G A 7: 44,393,442 V383I probably benign Het
Tle6 T A 10: 81,594,401 I306F probably damaging Het
Tox3 G A 8: 90,248,390 Q538* probably null Het
Trim24 T A 6: 37,956,453 S656T probably damaging Het
Trnau1ap C A 4: 132,321,734 V119F possibly damaging Het
Vmn1r181 G T 7: 23,984,518 S136I possibly damaging Het
Vmn1r82 T C 7: 12,305,406 V202A probably damaging Het
Zfp607b G A 7: 27,702,394 V92I probably benign Het
Zfp964 G C 8: 69,663,854 C368S unknown Het
Zw10 A G 9: 49,057,641 probably null Het
Other mutations in Abca8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abca8a APN 11 110050939 missense possibly damaging 0.52
IGL01099:Abca8a APN 11 110074205 splice site probably benign
IGL01100:Abca8a APN 11 110058423 critical splice donor site probably null
IGL01310:Abca8a APN 11 110059975 missense probably benign 0.02
IGL01357:Abca8a APN 11 110031572 missense probably benign 0.05
IGL01554:Abca8a APN 11 110042166 missense probably benign 0.24
IGL01937:Abca8a APN 11 110083304 splice site probably benign
IGL01945:Abca8a APN 11 110083304 splice site probably benign
IGL01987:Abca8a APN 11 110074155 missense possibly damaging 0.63
IGL02023:Abca8a APN 11 110063116 missense probably benign 0.04
IGL02208:Abca8a APN 11 110059946 missense probably damaging 1.00
IGL02378:Abca8a APN 11 110078815 unclassified probably benign
IGL02380:Abca8a APN 11 110078815 unclassified probably benign
IGL02387:Abca8a APN 11 110078815 unclassified probably benign
IGL02388:Abca8a APN 11 110078815 unclassified probably benign
IGL02524:Abca8a APN 11 110078815 unclassified probably benign
IGL02551:Abca8a APN 11 110084242 missense probably benign 0.05
IGL02831:Abca8a APN 11 110053081 missense probably damaging 1.00
IGL02836:Abca8a APN 11 110070351 missense possibly damaging 0.89
IGL02934:Abca8a APN 11 110040588 missense probably damaging 1.00
IGL02946:Abca8a APN 11 110028215 splice site probably benign
IGL02967:Abca8a APN 11 110050936 missense probably damaging 1.00
IGL02997:Abca8a APN 11 110075533 splice site probably benign
IGL03265:Abca8a APN 11 110053103 missense probably benign 0.01
G5030:Abca8a UTSW 11 110070339 missense probably damaging 1.00
H8562:Abca8a UTSW 11 110043009 missense probably benign
PIT4445001:Abca8a UTSW 11 110075551 missense probably damaging 0.99
R0060:Abca8a UTSW 11 110070480 missense probably damaging 1.00
R0060:Abca8a UTSW 11 110070480 missense probably damaging 1.00
R0084:Abca8a UTSW 11 110036597 splice site probably benign
R0394:Abca8a UTSW 11 110026343 missense probably damaging 0.99
R0477:Abca8a UTSW 11 110065225 missense probably benign
R0593:Abca8a UTSW 11 110068099 missense probably damaging 1.00
R0744:Abca8a UTSW 11 110040564 missense possibly damaging 0.91
R0764:Abca8a UTSW 11 110059946 missense probably damaging 1.00
R0787:Abca8a UTSW 11 110042988 missense possibly damaging 0.60
R0836:Abca8a UTSW 11 110040564 missense possibly damaging 0.91
R0848:Abca8a UTSW 11 110028190 missense probably damaging 1.00
R0894:Abca8a UTSW 11 110050966 missense probably benign 0.00
R1163:Abca8a UTSW 11 110071530 missense probably benign 0.01
R1224:Abca8a UTSW 11 110040582 missense probably damaging 1.00
R1474:Abca8a UTSW 11 110069809 missense probably damaging 1.00
R1596:Abca8a UTSW 11 110068060 missense possibly damaging 0.89
R1708:Abca8a UTSW 11 110053102 missense probably damaging 1.00
R1715:Abca8a UTSW 11 110091580 missense probably damaging 0.98
R1795:Abca8a UTSW 11 110050966 missense probably benign 0.00
R1832:Abca8a UTSW 11 110071451 missense probably damaging 0.99
R1852:Abca8a UTSW 11 110069386 missense probably damaging 1.00
R1887:Abca8a UTSW 11 110089942 missense probably damaging 1.00
R1891:Abca8a UTSW 11 110091607 missense probably benign 0.20
R1917:Abca8a UTSW 11 110091515 splice site probably benign
R1943:Abca8a UTSW 11 110069863 missense probably benign 0.00
R1962:Abca8a UTSW 11 110026905 critical splice acceptor site probably null
R2016:Abca8a UTSW 11 110070387 missense probably damaging 0.99
R2037:Abca8a UTSW 11 110089984 intron probably null
R2098:Abca8a UTSW 11 110036579 missense probably damaging 1.00
R2102:Abca8a UTSW 11 110068052 missense probably damaging 1.00
R2134:Abca8a UTSW 11 110030917 missense probably null 1.00
R2220:Abca8a UTSW 11 110026855 missense probably damaging 1.00
R2269:Abca8a UTSW 11 110026892 missense probably damaging 1.00
R2395:Abca8a UTSW 11 110068788 missense probably damaging 1.00
R2847:Abca8a UTSW 11 110042105 missense probably damaging 1.00
R3508:Abca8a UTSW 11 110063165 missense probably benign
R3974:Abca8a UTSW 11 110083502 missense probably damaging 1.00
R4009:Abca8a UTSW 11 110090107 missense probably damaging 0.98
R4163:Abca8a UTSW 11 110050982 missense probably benign 0.00
R4274:Abca8a UTSW 11 110090104 missense probably damaging 0.96
R4507:Abca8a UTSW 11 110063025 missense probably benign 0.19
R4571:Abca8a UTSW 11 110030058 missense probably damaging 1.00
R4672:Abca8a UTSW 11 110071876 missense possibly damaging 0.94
R4700:Abca8a UTSW 11 110070482 missense probably damaging 1.00
R4770:Abca8a UTSW 11 110071515 missense possibly damaging 0.82
R4946:Abca8a UTSW 11 110086474 missense probably damaging 1.00
R4955:Abca8a UTSW 11 110036512 missense probably benign 0.00
R5186:Abca8a UTSW 11 110091599 missense probably null 0.31
R5190:Abca8a UTSW 11 110089909 critical splice donor site probably null
R5597:Abca8a UTSW 11 110036537 missense probably damaging 1.00
R5677:Abca8a UTSW 11 110038399 missense possibly damaging 0.51
R5757:Abca8a UTSW 11 110042968 missense probably benign 0.28
R5822:Abca8a UTSW 11 110030879 missense probably damaging 0.98
R5925:Abca8a UTSW 11 110057223 missense probably damaging 1.00
R6090:Abca8a UTSW 11 110063222 critical splice acceptor site probably null
R6122:Abca8a UTSW 11 110070423 missense probably benign 0.40
R6189:Abca8a UTSW 11 110030884 missense probably damaging 1.00
R6200:Abca8a UTSW 11 110090050 missense probably damaging 0.98
R6374:Abca8a UTSW 11 110083390 nonsense probably null
R7022:Abca8a UTSW 11 110083500 missense probably damaging 1.00
R7161:Abca8a UTSW 11 110074142 missense probably benign 0.09
R7198:Abca8a UTSW 11 110078655 missense probably damaging 1.00
R7220:Abca8a UTSW 11 110089967 missense probably benign 0.00
R7290:Abca8a UTSW 11 110030888 missense probably benign 0.03
R7381:Abca8a UTSW 11 110030087 intron probably null
R7437:Abca8a UTSW 11 110050964 missense probably benign
R7733:Abca8a UTSW 11 110054587 missense probably benign 0.02
R7785:Abca8a UTSW 11 110074206 splice site probably null
R7948:Abca8a UTSW 11 110050979 missense probably benign
R8033:Abca8a UTSW 11 110036522 missense probably damaging 1.00
R8069:Abca8a UTSW 11 110090050 missense probably damaging 0.98
R8116:Abca8a UTSW 11 110091594 missense probably benign 0.27
X0022:Abca8a UTSW 11 110031097 missense probably damaging 1.00
X0024:Abca8a UTSW 11 110083335 missense probably damaging 1.00
X0053:Abca8a UTSW 11 110083484 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGATGGAGCCCTGGATTTC -3'
(R):5'- CCTGTACACATCTGTAGAAGGC -3'

Sequencing Primer
(F):5'- GACCTGTTTTGACCATGGTTAC -3'
(R):5'- ACACATCTGTAGAAGGCTGTTTGC -3'
Posted On2014-12-04