Incidental Mutation 'R2849:Atxn1'
ID252015
Institutional Source Beutler Lab
Gene Symbol Atxn1
Ensembl Gene ENSMUSG00000046876
Gene Nameataxin 1
Synonyms2900016G23Rik, Atx1, Sca1
MMRRC Submission 040442-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2849 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location45549755-45965008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45566699 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 573 (D573E)
Ref Sequence ENSEMBL: ENSMUSP00000137439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091628] [ENSMUST00000167708] [ENSMUST00000180110]
Predicted Effect probably damaging
Transcript: ENSMUST00000091628
AA Change: D573E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089217
Gene: ENSMUSG00000046876
AA Change: D573E

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 153 168 N/A INTRINSIC
Pfam:ATXN-1_C 391 421 8.7e-15 PFAM
AXH 545 664 1.42e-82 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167708
AA Change: D573E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129890
Gene: ENSMUSG00000046876
AA Change: D573E

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 153 168 N/A INTRINSIC
Pfam:ATXN-1_C 391 421 8.7e-15 PFAM
AXH 545 664 1.42e-82 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000180110
AA Change: D573E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137439
Gene: ENSMUSG00000046876
AA Change: D573E

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 153 168 N/A INTRINSIC
Pfam:ATXN-1_C 402 421 3e-10 PFAM
low complexity region 537 548 N/A INTRINSIC
Pfam:AXH 550 671 1.1e-44 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The autosomal dominant cerebellar ataxias (ADCA) are a heterogeneous group of neurodegenerative disorders characterized by progressive degeneration of the cerebellum, brain stem and spinal cord. Clinically, ADCA has been divided into three groups: ADCA types I-III. ADCAI is genetically heterogeneous, with five genetic loci, designated spinocerebellar ataxia (SCA) 1, 2, 3, 4 and 6, being assigned to five different chromosomes. ADCAII, which always presents with retinal degeneration (SCA7), and ADCAIII often referred to as the `pure' cerebellar syndrome (SCA5), are most likely homogeneous disorders. Several SCA genes have been cloned and shown to contain CAG repeats in their coding regions. ADCA is caused by the expansion of the CAG repeats, producing an elongated polyglutamine tract in the corresponding protein. The expanded repeats are variable in size and unstable, usually increasing in size when transmitted to successive generations. The function of the ataxins is not known. This locus has been mapped to chromosome 6, and it has been determined that the diseased allele contains 40-83 CAG repeats, compared to 6-39 in the normal allele, and is associated with spinocerebellar ataxia type 1 (SCA1). At least two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased exploration, impaired spatial working memory, impaired coordination, and decreased paired-pulse facilitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G C 17: 24,289,507 T1018R probably damaging Het
Abca8a T C 11: 110,042,105 D1231G probably damaging Het
Adcy7 A G 8: 88,327,393 I1017V probably benign Het
Agpat2 A G 2: 26,597,239 I109T probably damaging Het
Aldh9a1 G A 1: 167,352,628 R97H probably damaging Het
Als2 G A 1: 59,206,538 T593M probably damaging Het
Ap3d1 G C 10: 80,741,908 H28Q possibly damaging Het
BC100530 T A 16: 36,367,452 Q17L probably damaging Het
Begain T A 12: 109,033,118 M576L probably benign Het
Bod1l T C 5: 41,838,076 N109S probably damaging Het
Boll A G 1: 55,346,373 M131T possibly damaging Het
Celf2 T C 2: 6,604,125 R282G probably damaging Het
Cers2 T C 3: 95,322,459 F330L probably benign Het
Chst13 T C 6: 90,309,158 D274G probably benign Het
Dclk2 A G 3: 86,793,223 V649A probably damaging Het
Deaf1 T C 7: 141,314,454 *54W probably null Het
Fbf1 C T 11: 116,157,688 probably null Het
Fbxo32 C T 15: 58,207,972 S71N probably benign Het
Fbxo42 T A 4: 141,200,510 N700K probably damaging Het
Fis1 T C 5: 136,963,117 I55T possibly damaging Het
Fyco1 A T 9: 123,834,826 L121* probably null Het
Gm2381 G A 7: 42,820,407 P98S probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Gtf2ird1 G A 5: 134,359,007 T946I probably damaging Het
Hmcn1 G T 1: 150,563,599 Y5494* probably null Het
Josd2 A G 7: 44,468,973 probably null Het
Lfng T A 5: 140,611,867 D149E probably damaging Het
Lrp1 C T 10: 127,542,296 A4052T probably damaging Het
Lrrtm3 T C 10: 64,089,031 N119S probably damaging Het
Lypd6 C T 2: 50,165,652 P38L probably damaging Het
Msl3l2 T C 10: 56,115,442 C88R probably benign Het
Nsd1 A G 13: 55,213,692 T158A probably damaging Het
Nudt22 A T 19: 6,993,484 S239R probably benign Het
Odf3 A G 7: 140,849,269 T156A probably benign Het
Olfr1288 T C 2: 111,479,354 M190T probably benign Het
Olfr584 A T 7: 103,086,112 D193V probably damaging Het
Osbpl8 T A 10: 111,269,436 S251T probably benign Het
Otop3 T C 11: 115,344,558 F339L probably damaging Het
Pcdhga10 T A 18: 37,748,200 V338E possibly damaging Het
Pcnx2 A G 8: 125,760,927 F1779S probably damaging Het
Plxna4 T C 6: 32,185,532 K1349E probably damaging Het
Poteg A T 8: 27,481,676 N406I probably benign Het
Ppp4r4 T C 12: 103,606,933 V697A probably benign Het
Ptpra C A 2: 130,544,999 H603Q probably benign Het
Rnf10 T C 5: 115,249,112 D439G probably benign Het
Rnf43 T A 11: 87,732,267 N731K probably benign Het
Slc2a4 T A 11: 69,946,171 N116Y probably damaging Het
Slc6a15 C A 10: 103,404,691 H392N probably benign Het
Slco6d1 C T 1: 98,466,716 T375I probably benign Het
Smpd4 A G 16: 17,642,212 D436G probably damaging Het
Spata22 G A 11: 73,353,745 W311* probably null Het
Syt3 G A 7: 44,393,442 V383I probably benign Het
Tle6 T A 10: 81,594,401 I306F probably damaging Het
Tox3 G A 8: 90,248,390 Q538* probably null Het
Trim24 T A 6: 37,956,453 S656T probably damaging Het
Trnau1ap C A 4: 132,321,734 V119F possibly damaging Het
Vmn1r181 G T 7: 23,984,518 S136I possibly damaging Het
Vmn1r82 T C 7: 12,305,406 V202A probably damaging Het
Zfp607b G A 7: 27,702,394 V92I probably benign Het
Zfp964 G C 8: 69,663,854 C368S unknown Het
Zw10 A G 9: 49,057,641 probably null Het
Other mutations in Atxn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Atxn1 APN 13 45568427 utr 5 prime probably benign
IGL01467:Atxn1 APN 13 45567193 missense probably damaging 1.00
IGL01482:Atxn1 APN 13 45557314 missense probably benign 0.00
IGL01512:Atxn1 APN 13 45566601 missense probably damaging 0.99
IGL01735:Atxn1 APN 13 45566722 missense probably damaging 1.00
IGL02005:Atxn1 APN 13 45568225 missense probably benign 0.00
IGL02333:Atxn1 APN 13 45567204 missense probably damaging 1.00
Cormorant UTSW 13 45557069 missense probably damaging 1.00
pelagic UTSW 13 45566812 missense probably benign 0.05
R0136:Atxn1 UTSW 13 45567169 missense probably damaging 0.99
R0180:Atxn1 UTSW 13 45557548 missense probably damaging 1.00
R0299:Atxn1 UTSW 13 45567169 missense probably damaging 0.99
R0540:Atxn1 UTSW 13 45557530 missense probably damaging 1.00
R1220:Atxn1 UTSW 13 45557423 missense probably benign 0.08
R1484:Atxn1 UTSW 13 45557576 nonsense probably null
R1532:Atxn1 UTSW 13 45566910 missense possibly damaging 0.95
R1885:Atxn1 UTSW 13 45567804 missense probably benign 0.27
R2277:Atxn1 UTSW 13 45557068 missense probably damaging 0.99
R2847:Atxn1 UTSW 13 45566699 missense probably damaging 1.00
R4326:Atxn1 UTSW 13 45965967 unclassified probably benign
R4626:Atxn1 UTSW 13 45567099 missense probably damaging 1.00
R4768:Atxn1 UTSW 13 45557548 missense probably damaging 1.00
R4944:Atxn1 UTSW 13 45566931 missense probably damaging 1.00
R5011:Atxn1 UTSW 13 45557069 missense probably damaging 1.00
R5061:Atxn1 UTSW 13 45557093 missense probably damaging 1.00
R5293:Atxn1 UTSW 13 45568368 missense probably damaging 1.00
R5299:Atxn1 UTSW 13 45557254 missense probably benign 0.14
R5561:Atxn1 UTSW 13 45566871 missense possibly damaging 0.49
R5667:Atxn1 UTSW 13 45557377 missense probably benign 0.17
R6092:Atxn1 UTSW 13 45566812 missense probably benign 0.05
R6272:Atxn1 UTSW 13 45567762 missense possibly damaging 0.49
R6372:Atxn1 UTSW 13 45557456 missense probably damaging 1.00
R6688:Atxn1 UTSW 13 45567671 missense probably damaging 0.99
R6997:Atxn1 UTSW 13 45567619 missense probably benign 0.04
R7041:Atxn1 UTSW 13 45566835 missense probably damaging 1.00
R7578:Atxn1 UTSW 13 45567358 missense probably benign 0.02
R7600:Atxn1 UTSW 13 45557060 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGTAATCACCATGCCAGGAG -3'
(R):5'- GAGAACTTCAACCCAGAGGC -3'

Sequencing Primer
(F):5'- TCACCATGCCAGGAGATGATAG -3'
(R):5'- AGAGGCTCTGGTCACCC -3'
Posted On2014-12-04