Mutagenetix > Incidental Mutations

Incidental Mutation 'R2510:Rims2'

252024

Institutional Source

Beutler Lab

Gene Symbol

Rims2

Ensembl Gene

ENSMUSG00000037386

Gene Name

regulating synaptic membrane exocytosis 2

Synonyms

2810036I15Rik, Syt3-rs, RIM2

MMRRC Submission

040416-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.681) question?

Stock #

R2510 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

39198261-39684372 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 39585652 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 1217 (S1217R)

Ref Sequence

ENSEMBL: ENSMUSP00000048719 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042917] [ENSMUST00000082054] [ENSMUST00000227243]

Predicted Effect

probably damaging
Transcript: ENSMUST00000042917
AA Change: S1217R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000048719
Gene: ENSMUSG00000037386
AA Change: S1217R

Domain	Start	End	E-Value	Type
low complexity region	3	24	N/A	INTRINSIC
Pfam:FYVE_2	30	154	9.5e-18	PFAM
low complexity region	315	335	N/A	INTRINSIC
low complexity region	492	498	N/A	INTRINSIC
low complexity region	511	521	N/A	INTRINSIC
low complexity region	527	540	N/A	INTRINSIC
PDZ	646	725	8.27e-16	SMART
low complexity region	740	748	N/A	INTRINSIC
C2	790	897	4.08e-21	SMART
low complexity region	905	919	N/A	INTRINSIC
low complexity region	1085	1101	N/A	INTRINSIC
low complexity region	1116	1130	N/A	INTRINSIC
low complexity region	1208	1238	N/A	INTRINSIC
C2	1432	1535	3.78e-16	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000082054
AA Change: S1175R

PolyPhen 2 Score 0.563 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000080711
Gene: ENSMUSG00000037386
AA Change: S1175R

Domain	Start	End	E-Value	Type
low complexity region	3	24	N/A	INTRINSIC
Pfam:FYVE_2	76	194	2.2e-11	PFAM
low complexity region	355	375	N/A	INTRINSIC
low complexity region	532	538	N/A	INTRINSIC
low complexity region	551	561	N/A	INTRINSIC
low complexity region	567	580	N/A	INTRINSIC
PDZ	686	765	8.27e-16	SMART
low complexity region	780	788	N/A	INTRINSIC
C2	830	937	4.08e-21	SMART
low complexity region	945	959	N/A	INTRINSIC
low complexity region	1075	1086	N/A	INTRINSIC
low complexity region	1166	1196	N/A	INTRINSIC
C2	1390	1493	3.78e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000227243
AA Change: S1195R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

unknown
Transcript: ENSMUST00000227381
AA Change: S915R

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227830

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228269

Meta Mutation Damage Score

0.2962

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 94.9%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a presynaptic protein that interacts with RAB3, a protein important for normal neurotransmitter release. The encoded protein can also bind several other synaptic proteins, including UNC-13 homolog B, ELKS/Rab6-interacting/CAST family member 1, and synaptotagmin 1. This protein is involved in synaptic membrane exocytosis. Polymorphisms in this gene have been associated with degenerative lumbar scoliosis. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele show reduced body size, aberrant insulin granule exocytosis, and impaired secretion of hormones associated with glucose homeostasis. Mice homozygous for another knock-out allele show a slightly reduced body size, abnormal maternal behavior and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	T	C	1: 37,625,300	M506V	probably benign	Het
4930571K23Rik	C	A	7: 125,369,139		noncoding transcript	Het
Adra1d	C	A	2: 131,562,135	E12*	probably null	Het
Ago4	A	T	4: 126,517,071	D208E	probably damaging	Het
Agrn	A	T	4: 156,166,424		probably null	Het
Atxn2	C	T	5: 121,781,393	S388L	probably damaging	Het
Bbox1	A	T	2: 110,305,631	M1K	probably null	Het
Btaf1	G	A	19: 37,002,445	R1538H	probably benign	Het
Car11	G	A	7: 45,701,359	G93E	probably damaging	Het
Col18a1	A	G	10: 77,096,268	L329P	unknown	Het
Copb2	T	A	9: 98,571,648		probably benign	Het
Dnah2	G	T	11: 69,524,206	S234*	probably null	Het
Dnah9	T	C	11: 66,005,169	Y2460C	probably damaging	Het
Dnaic2	G	C	11: 114,757,167		probably benign	Het
Dst	C	A	1: 34,212,286	T1814K	probably benign	Het
F11	A	G	8: 45,248,638	S353P	probably damaging	Het
Fancm	A	T	12: 65,113,770		probably benign	Het
Fsip2	T	C	2: 82,986,438	S4172P	probably benign	Het
G530012D18Rik	T	G	1: 85,577,204		probably benign	Het
Gca	T	G	2: 62,689,974	S159R	probably damaging	Het
Gja8	T	G	3: 96,919,717	T210P	probably damaging	Het
Gm10639	T	A	9: 78,294,807	M1K	probably null	Het
Gm13103	G	A	4: 143,851,991	V274I	probably benign	Het
Gm5117	T	A	8: 31,738,355		noncoding transcript	Het
Gm5900	T	A	7: 104,950,364		noncoding transcript	Het
Gpi1	A	G	7: 34,205,923	S359P	probably damaging	Het
Grm5	A	G	7: 88,036,091	E472G	probably benign	Het
Hoxd12	G	A	2: 74,675,471	A129T	possibly damaging	Het
Ifnlr1	G	T	4: 135,705,248	D332Y	probably damaging	Het
Ift140	T	C	17: 25,036,308	I466T	probably benign	Het
Kansl2	A	G	15: 98,528,861		probably null	Het
Kat2a	T	C	11: 100,712,142	Q88R	probably benign	Het
Kcnh7	T	C	2: 62,721,917	D910G	probably benign	Het
Klk1b1	T	C	7: 43,969,379	V60A	probably damaging	Het
Krt7	A	C	15: 101,412,657	I62L	probably benign	Het
Llgl1	A	G	11: 60,710,036	K653E	probably damaging	Het
Lmo2	T	C	2: 103,981,062	Y147H	probably damaging	Het
Mafb	T	G	2: 160,366,576	E34A	probably damaging	Het
Meiob	T	C	17: 24,816,597		probably benign	Het
Mllt10	C	A	2: 18,065,124	D30E	possibly damaging	Het
Mprip	T	A	11: 59,749,508		probably benign	Het
Muc5b	A	T	7: 141,859,061	N1915Y	unknown	Het
Mycbp2	C	T	14: 103,155,255	R3290Q	probably damaging	Het
Obscn	G	A	11: 59,042,314		probably benign	Het
Olfm3	T	A	3: 115,122,310	V277D	probably damaging	Het
Olfr1271	C	T	2: 90,265,606	V275I	probably damaging	Het
Olfr1286	G	A	2: 111,420,451	P167S	possibly damaging	Het
Olfr668	G	A	7: 104,925,687	H26Y	probably benign	Het
Olfr960	T	A	9: 39,623,431	F101I	probably damaging	Het
Omp	A	T	7: 98,145,345	M25K	possibly damaging	Het
Otoa	C	T	7: 121,160,472	T1099I	probably benign	Het
Pcdh15	T	G	10: 74,631,499	S1715A	probably benign	Het
Pcnx4	T	C	12: 72,566,972	W564R	probably damaging	Het
Pde12	T	C	14: 26,665,526	*609W	probably null	Het
Pitpnm2	T	C	5: 124,136,326	E240G	probably damaging	Het
Plppr4	G	T	3: 117,331,706	N161K	probably damaging	Het
Ppp1r37	T	C	7: 19,532,432	K470E	possibly damaging	Het
Ptprd	C	A	4: 76,086,011		probably null	Het
Rgs9	T	C	11: 109,268,972	Y178C	probably benign	Het
Rorc	C	T	3: 94,389,120	T208I	probably benign	Het
Ryr3	C	T	2: 112,675,904	E3458K	probably benign	Het
Scn5a	A	T	9: 119,533,685	V623E	probably benign	Het
Slc28a2	C	T	2: 122,451,016	Q229*	probably null	Het
Slc35f3	C	T	8: 126,298,706		probably benign	Het
Spg11	T	G	2: 122,075,310	I1285L	probably benign	Het
Sstr2	A	T	11: 113,624,923	I223F	probably damaging	Het
Susd1	A	T	4: 59,349,855	V527E	possibly damaging	Het
Tas1r2	A	G	4: 139,659,851	N207S	probably damaging	Het
Tmem57	A	G	4: 134,804,388	S657P	probably damaging	Het
Trappc10	A	G	10: 78,211,523	S380P	possibly damaging	Het
Ttn	T	C	2: 76,740,992	D26519G	probably damaging	Het
Vmn1r215	A	G	13: 23,076,173	I128V	probably benign	Het
Vmn1r37	T	C	6: 66,731,951	L150P	probably damaging	Het
Vmn2r52	G	T	7: 10,170,868	A348E	probably benign	Het
Vmn2r-ps159	G	T	4: 156,334,397		noncoding transcript	Het
Wdyhv1	C	A	15: 58,153,624	A145D	probably damaging	Het
Ypel5	T	C	17: 72,846,391	L30P	probably damaging	Het
Zfp985	A	G	4: 147,582,986	T104A	possibly damaging	Het

Other mutations in Rims2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Rims2	APN	15	39459615	missense	probably benign	0.11
IGL00502:Rims2	APN	15	39506984	missense	probably damaging	1.00
IGL00556:Rims2	APN	15	39456674	splice site	probably null
IGL00811:Rims2	APN	15	39292149	missense	probably damaging	1.00
IGL00827:Rims2	APN	15	39472359	missense	probably damaging	0.99
IGL01642:Rims2	APN	15	39457796	missense	probably damaging	1.00
IGL02951:Rims2	APN	15	39534938	missense	probably damaging	1.00
IGL03009:Rims2	APN	15	39566997	missense	possibly damaging	0.85
IGL03080:Rims2	APN	15	39535903	missense	probably damaging	1.00
IGL03102:Rims2	APN	15	39459593	missense	possibly damaging	0.95
IGL03252:Rims2	APN	15	39452352	missense	probably benign
IGL03365:Rims2	APN	15	39476541	missense	probably damaging	1.00
IGL03393:Rims2	APN	15	39462613	splice site	probably null
IGL03409:Rims2	APN	15	39456733	missense	probably damaging	1.00
PIT4486001:Rims2	UTSW	15	39476520	missense	possibly damaging	0.67
R0009:Rims2	UTSW	15	39534966	missense	probably damaging	0.99
R0009:Rims2	UTSW	15	39534966	missense	probably damaging	0.99
R0078:Rims2	UTSW	15	39534855	missense	probably benign	0.42
R0367:Rims2	UTSW	15	39462615	splice site	probably null
R0401:Rims2	UTSW	15	39509632	splice site	probably benign
R0531:Rims2	UTSW	15	39567030	missense	probably damaging	1.00
R0791:Rims2	UTSW	15	39679625	splice site	probably benign
R0838:Rims2	UTSW	15	39681025	missense	probably benign	0.02
R1201:Rims2	UTSW	15	39616324	missense	possibly damaging	0.91
R1318:Rims2	UTSW	15	39517826	missense	probably damaging	0.99
R1457:Rims2	UTSW	15	39511314	missense	possibly damaging	0.63
R1619:Rims2	UTSW	15	39506986	missense	probably damaging	1.00
R1672:Rims2	UTSW	15	39292189	missense	probably benign	0.09
R1743:Rims2	UTSW	15	39679650	missense	probably benign	0.10
R1766:Rims2	UTSW	15	39462580	missense	probably damaging	0.99
R1779:Rims2	UTSW	15	39681702	missense	probably damaging	1.00
R1804:Rims2	UTSW	15	39437043	nonsense	probably null
R1985:Rims2	UTSW	15	39345314	missense	probably damaging	0.99
R1986:Rims2	UTSW	15	39345314	missense	probably damaging	0.99
R2113:Rims2	UTSW	15	39511326	missense	probably benign	0.17
R2260:Rims2	UTSW	15	39478566	nonsense	probably null
R3693:Rims2	UTSW	15	39478575	missense	probably benign	0.01
R3937:Rims2	UTSW	15	39437845	missense	probably damaging	1.00
R4425:Rims2	UTSW	15	39437924	critical splice donor site	probably null
R4453:Rims2	UTSW	15	39292208	missense	probably damaging	1.00
R4474:Rims2	UTSW	15	39462560	missense	probably damaging	1.00
R4518:Rims2	UTSW	15	39437526	missense	probably damaging	1.00
R4526:Rims2	UTSW	15	39437717	missense	probably damaging	1.00
R4833:Rims2	UTSW	15	39535914	missense	probably damaging	0.98
R4936:Rims2	UTSW	15	39437728	missense	probably damaging	1.00
R4993:Rims2	UTSW	15	39454445	missense	possibly damaging	0.90
R5001:Rims2	UTSW	15	39452428	missense	probably benign	0.03
R5054:Rims2	UTSW	15	39517869	intron	probably null
R5072:Rims2	UTSW	15	39462590	missense	probably benign	0.01
R5171:Rims2	UTSW	15	39437103	missense	probably damaging	1.00
R5429:Rims2	UTSW	15	39345355	missense	probably damaging	1.00
R5623:Rims2	UTSW	15	39478615	missense	probably damaging	1.00
R5624:Rims2	UTSW	15	39345413	missense	possibly damaging	0.46
R5685:Rims2	UTSW	15	39437206	missense	possibly damaging	0.67
R5784:Rims2	UTSW	15	39535987	splice site	probably null
R5790:Rims2	UTSW	15	39681045	missense	probably damaging	1.00
R5822:Rims2	UTSW	15	39476490	missense	probably damaging	1.00
R5963:Rims2	UTSW	15	39437182	missense	probably damaging	1.00
R5988:Rims2	UTSW	15	39292182	missense	probably damaging	1.00
R6057:Rims2	UTSW	15	39675020	missense	probably damaging	1.00
R6239:Rims2	UTSW	15	39198363	start codon destroyed	unknown
R6407:Rims2	UTSW	15	39452328	missense	probably damaging	1.00
R6418:Rims2	UTSW	15	39509696	missense	probably damaging	1.00
R6495:Rims2	UTSW	15	39517812	missense	probably benign	0.01
R6502:Rims2	UTSW	15	39534855	missense	probably benign	0.42
R6753:Rims2	UTSW	15	39566973	missense	possibly damaging	0.74
R6855:Rims2	UTSW	15	39345515	missense	probably benign	0.06
R6948:Rims2	UTSW	15	39511341	missense	probably benign
R7058:Rims2	UTSW	15	39585648	missense	probably damaging	1.00
R7167:Rims2	UTSW	15	39437077	missense	probably benign
R7217:Rims2	UTSW	15	39476489	missense	probably damaging	0.99
R7223:Rims2	UTSW	15	39437032	missense	probably benign	0.30
R7289:Rims2	UTSW	15	39437718	missense	probably benign	0.00
R7459:Rims2	UTSW	15	39517839	missense	probably benign
R7663:Rims2	UTSW	15	39507026	missense	probably damaging	1.00
R7792:Rims2	UTSW	15	39198528	missense	possibly damaging	0.69
X0034:Rims2	UTSW	15	39437534	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGTATTGCAGTACCCACCATG -3'
(R):5'- GTCATCAGTTCTACAAAACTTGACC -3'

Sequencing Primer
(F):5'- CCACCATGGACAGTTAAAGTGCTG -3'
(R):5'- ACCCTCTGAAGTACACAG -3'

Posted On

2014-12-04