Incidental Mutation 'R0311:Th'
ID 25203
Institutional Source Beutler Lab
Gene Symbol Th
Ensembl Gene ENSMUSG00000000214
Gene Name tyrosine hydroxylase
Synonyms
MMRRC Submission 038521-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0311 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 142892752-142931128 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 142896041 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 41 (E41G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000219] [ENSMUST00000105929] [ENSMUST00000123057] [ENSMUST00000124951] [ENSMUST00000140344]
AlphaFold P24529
Predicted Effect probably damaging
Transcript: ENSMUST00000000219
AA Change: E229G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000000219
Gene: ENSMUSG00000000214
AA Change: E229G

DomainStartEndE-ValueType
Pfam:TOH_N 2 26 2.3e-15 PFAM
Pfam:TOH_N 29 49 2.6e-11 PFAM
low complexity region 51 63 N/A INTRINSIC
PDB:2MDA|B 65 146 1e-49 PDB
low complexity region 147 158 N/A INTRINSIC
Pfam:Biopterin_H 165 495 1.2e-180 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105929
AA Change: E134G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101549
Gene: ENSMUSG00000000214
AA Change: E134G

DomainStartEndE-ValueType
PDB:2MDA|B 8 51 1e-21 PDB
low complexity region 52 63 N/A INTRINSIC
Pfam:Biopterin_H 70 401 2.2e-196 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123057
Predicted Effect probably damaging
Transcript: ENSMUST00000124951
AA Change: E229G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122876
Gene: ENSMUSG00000000214
AA Change: E229G

DomainStartEndE-ValueType
Pfam:TOH_N 2 26 5e-16 PFAM
Pfam:TOH_N 28 49 4.1e-10 PFAM
low complexity region 51 63 N/A INTRINSIC
PDB:2MDA|B 65 146 2e-52 PDB
low complexity region 147 158 N/A INTRINSIC
Pfam:Biopterin_H 165 232 7.2e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000138482
AA Change: E41G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000140344
SMART Domains Protein: ENSMUSP00000115434
Gene: ENSMUSG00000000214

DomainStartEndE-ValueType
Pfam:TOH_N 11 29 5.2e-9 PFAM
low complexity region 31 43 N/A INTRINSIC
PDB:2MDA|B 45 126 7e-53 PDB
low complexity region 127 138 N/A INTRINSIC
Pfam:Biopterin_H 145 171 3.9e-11 PFAM
Meta Mutation Damage Score 0.9686 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.6%
  • 20x: 91.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the conversion of tyrosine to dopamine. It is the rate-limiting enzyme in the synthesis of catecholamines, hence plays a key role in the physiology of adrenergic neurons. Mutations in this gene have been associated with autosomal recessive Segawa syndrome. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations are deficient in catecholamines, and usually die around embryonic day 11.5-15.5 due to cardiac failure. Treatment of the pregnant female with dihydroxyphenylalanine prevents prenatal mortality. Mice homozygous for hypomorphic targeted alleles are hypokinetic. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A C 7: 120,402,904 M1547L probably damaging Het
Abcb4 A G 5: 8,934,243 K658E probably benign Het
Abr A G 11: 76,509,127 S15P possibly damaging Het
Adgrb2 G C 4: 130,017,129 A1168P probably damaging Het
Adgre4 A T 17: 55,802,010 E339V probably benign Het
Asprv1 T C 6: 86,628,840 W223R probably damaging Het
Ccdc89 A G 7: 90,426,693 E37G probably damaging Het
Cd48 C A 1: 171,699,580 Y191* probably null Het
Chd4 T C 6: 125,101,665 I257T probably benign Het
Clca4b T C 3: 144,932,496 M2V probably benign Het
Dnah11 A T 12: 118,127,133 D1025E probably benign Het
Erich5 A G 15: 34,472,939 *363W probably null Het
Etl4 A G 2: 20,807,129 D1341G probably damaging Het
Fbxw11 A G 11: 32,722,083 T184A probably benign Het
Fktn A G 4: 53,744,620 Q300R probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gdpd3 G A 7: 126,767,189 R66Q possibly damaging Het
Hexb A G 13: 97,183,819 probably benign Het
Kdm4b A G 17: 56,386,200 R346G probably benign Het
Mbtd1 T A 11: 93,921,357 probably null Het
Med23 T A 10: 24,897,358 C653S possibly damaging Het
Nwd2 A T 5: 63,804,998 I642L probably damaging Het
Olfr1444 A G 19: 12,861,869 I31M probably benign Het
Olfr1448 T A 19: 12,920,096 Y71F possibly damaging Het
Olfr912 T C 9: 38,539,297 V134A probably benign Het
Pbld2 T C 10: 63,054,507 probably null Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Plpp2 C T 10: 79,527,580 R77K probably damaging Het
Pym1 G T 10: 128,765,984 R168L possibly damaging Het
Rbm4 T C 19: 4,787,556 Y300C probably damaging Het
Rnf207 A G 4: 152,315,779 C175R probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Speg T C 1: 75,430,937 V3196A probably damaging Het
Syne1 T A 10: 5,348,943 I1048L possibly damaging Het
Tmx4 T A 2: 134,598,526 *336L probably null Het
Tnfrsf18 T C 4: 156,026,415 V10A possibly damaging Het
Tnxb A T 17: 34,716,984 I2670F probably damaging Het
Tpx2 T C 2: 152,890,492 V562A probably damaging Het
Vmn2r73 A G 7: 85,871,789 S324P probably benign Het
Vps18 T C 2: 119,297,365 Y890H probably benign Het
Ythdc1 G A 5: 86,835,705 D670N probably damaging Het
Other mutations in Th
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Th APN 7 142897026 missense probably benign 0.01
IGL02308:Th APN 7 142898057 missense possibly damaging 0.69
IGL02417:Th APN 7 142899906 missense probably damaging 1.00
IGL02565:Th APN 7 142899910 missense probably damaging 1.00
IGL02896:Th APN 7 142895431 missense probably damaging 1.00
R1072:Th UTSW 7 142894488 missense probably benign
R1595:Th UTSW 7 142897008 missense probably benign 0.06
R1756:Th UTSW 7 142898166 nonsense probably null
R2091:Th UTSW 7 142895543 missense probably damaging 0.98
R2850:Th UTSW 7 142894075 nonsense probably null
R3151:Th UTSW 7 142894075 nonsense probably null
R4458:Th UTSW 7 142896953 missense probably benign 0.41
R4870:Th UTSW 7 142894097 missense probably benign
R5382:Th UTSW 7 142895440 missense probably damaging 1.00
R7874:Th UTSW 7 142895571 nonsense probably null
R8049:Th UTSW 7 142894123 missense probably damaging 1.00
R8425:Th UTSW 7 142894086 missense possibly damaging 0.86
R8431:Th UTSW 7 142893064 missense probably benign 0.00
R8970:Th UTSW 7 142893059 missense probably damaging 1.00
R9484:Th UTSW 7 142899883 nonsense probably null
R9745:Th UTSW 7 142895114 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCGATAGCGACATCTCTGAATGAC -3'
(R):5'- CAATACAAGCAGTAAGGAGCCTGCC -3'

Sequencing Primer
(F):5'- GAATGACCTGATTATTTTGGGCCAC -3'
(R):5'- agactggggcagagagg -3'
Posted On 2013-04-16