Mutagenetix > Incidental Mutations

Incidental Mutation 'R2504:Epha4'

252045

Institutional Source

Beutler Lab

Gene Symbol

Epha4

Ensembl Gene

ENSMUSG00000026235

Gene Name

Eph receptor A4

Synonyms

rb, Sek, Sek1, 2900005C20Rik, Cek8, Hek8, Tyro1

MMRRC Submission

040412-MU

Accession Numbers

Genbank: NM_007936; MGI: 98277

Is this an essential gene?

Probably essential (E-score: 0.933) question?

Stock #

R2504 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

77367185-77515088 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 77382991 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Aspartic acid at position 742 (Y742D)

Ref Sequence

ENSEMBL: ENSMUSP00000139640 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027451] [ENSMUST00000188797] [ENSMUST00000188952] [ENSMUST00000190149]

PDB Structure

THE CRYSTAL STRUCTURE OF AN EPH RECEPTOR SAM DOMAIN REVEALS A MECHANISM FOR MODULAR DIMERIZATION. [X-RAY DIFFRACTION]
Crystal structure of a mutant EphA4 kinase domain (Y742A) [X-RAY DIFFRACTION]
Crystal structure of EphA4 kinase domain in complex with VUF 12058 [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF EPHA4 KINASE DOMAIN [X-RAY DIFFRACTION]
Crystal structure of EphA4 kinase domain in complex with Dasatinib. [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027451
AA Change: Y742D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027451
Gene: ENSMUSG00000026235
AA Change: Y742D

Domain	Start	End	E-Value	Type
EPH_lbd	30	204	1.35e-128	SMART
FN3	329	420	1.94e-8	SMART
FN3	441	522	9.18e-10	SMART
Pfam:EphA2_TM	548	618	1.7e-24	PFAM
TyrKc	621	878	1.91e-134	SMART
SAM	908	975	1.96e-20	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000188797
AA Change: Y742D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140954
Gene: ENSMUSG00000026235
AA Change: Y742D

Domain	Start	End	E-Value	Type
EPH_lbd	30	204	1.35e-128	SMART
FN3	329	420	1.94e-8	SMART
FN3	441	522	9.18e-10	SMART
Pfam:EphA2_TM	547	618	1.8e-27	PFAM
TyrKc	621	878	1.91e-134	SMART
SAM	908	975	1.96e-20	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000188952
AA Change: Y742D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139640
Gene: ENSMUSG00000026235
AA Change: Y742D

Domain	Start	End	E-Value	Type
EPH_lbd	30	204	1.35e-128	SMART
FN3	329	420	1.94e-8	SMART
FN3	441	522	9.18e-10	SMART
Pfam:EphA2_TM	547	618	1.8e-27	PFAM
TyrKc	621	878	1.91e-134	SMART
SAM	908	975	1.96e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000190149

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mutants are known for their "hopping gait". Homozygotes for targeted null mutations show loss of limb alternation in locomotion and axon guidance defects of the corticospinal tract within medulla and spinal cord, resulting in aberrant midline projections. Heterozygotes show less severe phenotype. [provided by MGI curators]

Allele List at MGI

All alleles(66) : Targeted, knock-out(3) Targeted, other(9) Gene trapped(52) Spontaneous(2)

Other mutations in this stock

Total: 113 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	G	A	15: 8,219,216	E1750K	probably damaging	Het
4933425L06Rik	A	G	13: 105,109,742	I270M	probably benign	Het
Aatk	T	C	11: 120,018,855	D28G	probably benign	Het
Abcg1	T	A	17: 31,092,395	S125T	probably damaging	Het
Actbl2	T	C	13: 111,256,183	S351P	possibly damaging	Het
Ankrd34b	A	G	13: 92,439,061		probably null	Het
BC030867	T	C	11: 102,255,296	Y133H	possibly damaging	Het
BC051665	C	T	13: 60,782,654	V295I	probably benign	Het
C1qtnf2	A	G	11: 43,491,156	N265S	probably damaging	Het
Ccdc14	C	T	16: 34,721,850	R573*	probably null	Het
Cd55b	A	T	1: 130,409,875	Y247N	probably damaging	Het
Celsr2	A	T	3: 108,413,591	V635E	probably benign	Het
Clec16a	T	C	16: 10,559,687		probably benign	Het
Clec4b1	A	G	6: 123,065,945	Y41C	probably damaging	Het
Cntn5	A	T	9: 10,172,121	D19E	probably benign	Het
Cop1	A	G	1: 159,232,805	N53S	probably damaging	Het
Csad	A	T	15: 102,188,667	M1K	probably null	Het
Cyb5rl	A	G	4: 107,080,945	I200V	probably benign	Het
Cyp26a1	A	G	19: 37,698,342	T81A	probably damaging	Het
Cyp2d12	A	T	15: 82,559,036	H433L	probably benign	Het
D7Ertd443e	T	A	7: 134,349,479		probably null	Het
Dennd1b	A	G	1: 139,170,170		probably benign	Het
Dmap1	G	T	4: 117,675,298	T357K	probably damaging	Het
Dzip1	G	T	14: 118,881,044	T759K	probably benign	Het
Elmo2	A	G	2: 165,298,687	V300A	probably damaging	Het
Eml5	T	C	12: 98,844,105	D864G	possibly damaging	Het
Ep400	A	G	5: 110,668,645	V2670A	probably damaging	Het
Epha3	T	A	16: 63,603,625	I534F	probably damaging	Het
Ergic2	A	G	6: 148,204,774		probably null	Het
Ero1l	A	T	14: 45,299,088		probably null	Het
Fam229a	A	G	4: 129,491,486	D70G	probably damaging	Het
Fbn2	C	T	18: 58,093,359	R781Q	probably damaging	Het
Fbxo16	A	T	14: 65,270,714		probably benign	Het
Fbxo39	T	A	11: 72,317,285	S154R	probably benign	Het
Fer	T	A	17: 63,991,580		probably null	Het
Filip1l	A	G	16: 57,570,662	I538V	possibly damaging	Het
Filip1l	A	T	16: 57,571,047	D428V	probably damaging	Het
Fsip2	T	C	2: 82,979,610	I2091T	possibly damaging	Het
Glyat	A	C	19: 12,651,398	T186P	possibly damaging	Het
Gm10604	A	G	4: 11,980,083	S74P	unknown	Het
Gm4787	T	G	12: 81,379,137	K82N	possibly damaging	Het
Hectd4	T	C	5: 121,220,620	I50T	unknown	Het
Hectd4	T	C	5: 121,263,967	S373P	possibly damaging	Het
Hmcn1	A	T	1: 150,686,867	C2313*	probably null	Het
Igfn1	A	T	1: 135,969,316	S1171T	probably benign	Het
Ints8	T	C	4: 11,241,642	D267G	probably benign	Het
Itln1	A	G	1: 171,529,159	C251R	probably damaging	Het
Jcad	C	T	18: 4,674,026	T596M	probably damaging	Het
Kcnj16	C	T	11: 111,025,583	T357M	probably benign	Het
Kif13a	G	A	13: 46,814,200	T346M	probably damaging	Het
Klhl24	G	A	16: 20,120,167	A491T	probably benign	Het
Kntc1	C	T	5: 123,778,347	Q748*	probably null	Het
Krt25	T	A	11: 99,317,296	K369*	probably null	Het
Krt75	C	T	15: 101,568,031	R433Q	probably benign	Het
Krt76	A	G	15: 101,884,858	F582L	unknown	Het
Lysmd1	G	A	3: 95,138,397	V182I	probably benign	Het
Mab21l2	T	A	3: 86,547,555	E46V	probably damaging	Het
Magi2	A	T	5: 20,358,936	K355N	probably damaging	Het
March10	T	C	11: 105,385,572	D630G	probably damaging	Het
Mast4	A	T	13: 102,738,639	I1215N	probably damaging	Het
Nckap1	G	A	2: 80,530,218	T523I	probably benign	Het
Nexmif	T	A	X: 104,084,393	D1306V	probably damaging	Het
Nfkb1	A	C	3: 135,589,329	I918R	possibly damaging	Het
Nup50	A	T	15: 84,933,658	T93S	probably benign	Het
Nwd2	T	C	5: 63,804,374	Y434H	probably benign	Het
Olfr61	T	C	7: 140,638,484	V261A	probably benign	Het
Osbpl1a	C	A	18: 12,905,031	V288L	probably benign	Het
Pan3	A	G	5: 147,527,036	E562G	possibly damaging	Het
Pappa	T	A	4: 65,180,889	Y548*	probably null	Het
Phf3	A	T	1: 30,810,789	L1181Q	probably damaging	Het
Phip	T	C	9: 82,915,339	H537R	possibly damaging	Het
Pkhd1l1	T	C	15: 44,485,428	I240T	probably damaging	Het
Pole	G	A	5: 110,290,502		probably null	Het
Polq	T	A	16: 37,011,942	S15T	unknown	Het
Prrt2	T	C	7: 127,020,224	E23G	possibly damaging	Het
Prss37	A	T	6: 40,517,826		probably null	Het
Prune2	T	C	19: 17,000,036	L45P	probably damaging	Het
Psd	A	T	19: 46,324,913	M6K	possibly damaging	Het
Psmd1	A	G	1: 86,089,997	E510G	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Pxdn	T	A	12: 30,003,406	I1194N	probably damaging	Het
Rbp3	C	T	14: 33,956,018	T641M	probably damaging	Het
Rgmb	C	A	17: 15,807,647	R270L	probably benign	Het
Rpgrip1l	A	G	8: 91,280,716		probably null	Het
Rps2	G	A	17: 24,720,379		probably benign	Het
Rsbn1l	G	T	5: 20,902,366	A550E	probably damaging	Het
S1pr4	C	T	10: 81,499,304	R112H	probably benign	Het
Scfd2	T	C	5: 74,531,177	N148S	probably damaging	Het
Scin	C	T	12: 40,081,706	M276I	probably benign	Het
Sec24d	T	C	3: 123,353,606	I708T	possibly damaging	Het
Skint11	T	A	4: 114,228,812	F41I	possibly damaging	Het
Slc15a4	A	T	5: 127,617,239	F44Y	possibly damaging	Het
Slc6a18	A	G	13: 73,675,806	Y72H	probably benign	Het
Slc7a11	A	T	3: 50,377,746		probably null	Het
Slc7a14	G	T	3: 31,237,501	N209K	possibly damaging	Het
Sstr2	T	C	11: 113,624,431	C59R	probably damaging	Het
Stab1	A	G	14: 31,163,040		probably null	Het
Stag1	G	T	9: 100,866,210	S475I	probably damaging	Het
Stxbp5l	A	G	16: 37,115,667	Y1183H	probably damaging	Het
Svep1	A	T	4: 58,135,628		probably null	Het
Tm9sf2	A	G	14: 122,158,684	T653A	probably benign	Het
Tmeff1	T	C	4: 48,662,059	S366P	possibly damaging	Het
Tnnt2	G	T	1: 135,852,065	W300L	probably damaging	Het
Traj32	A	G	14: 54,186,103		probably benign	Het
Trp53bp2	A	T	1: 182,441,639	M223L	probably benign	Het
Tsga10	G	A	1: 37,815,677	T246M	probably damaging	Het
Txn2	A	T	15: 77,926,670		probably benign	Het
Ubr3	T	A	2: 69,938,198	F450I	probably damaging	Het
Usp47	T	C	7: 112,104,470		probably null	Het
Vars2	C	T	17: 35,664,793	R244Q	probably damaging	Het
Xrra1	T	A	7: 99,897,596	F251L	probably damaging	Het
Zfp804a	G	A	2: 82,257,519	R564Q	probably benign	Het
Zfp983	T	C	17: 21,658,967	C29R	probably damaging	Het

Other mutations in Epha4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01315:Epha4	APN	1	77398557	missense	probably benign	0.00
IGL01350:Epha4	APN	1	77506855	missense	probably damaging	1.00
IGL01657:Epha4	APN	1	77426838	missense	probably damaging	1.00
IGL01872:Epha4	APN	1	77383039	missense	probably benign	0.03
IGL02366:Epha4	APN	1	77426711	nonsense	probably null
IGL02426:Epha4	APN	1	77444877	missense	probably benign	0.01
IGL02428:Epha4	APN	1	77506748	missense	possibly damaging	0.94
IGL02706:Epha4	APN	1	77426845	missense	probably damaging	1.00
IGL02716:Epha4	APN	1	77380965	missense	probably damaging	1.00
IGL03348:Epha4	APN	1	77507172	missense	possibly damaging	0.82
frog	UTSW	1	77481076	intron	probably benign
R0324:Epha4	UTSW	1	77383551	missense	probably damaging	1.00
R0392:Epha4	UTSW	1	77506973	missense	probably benign	0.00
R0538:Epha4	UTSW	1	77388541	missense	probably damaging	1.00
R0562:Epha4	UTSW	1	77388487	missense	probably benign	0.00
R0885:Epha4	UTSW	1	77382939	missense	probably damaging	0.99
R1509:Epha4	UTSW	1	77380886	missense	probably damaging	1.00
R1620:Epha4	UTSW	1	77374926	missense	probably benign	0.31
R1624:Epha4	UTSW	1	77399692	missense	probably damaging	1.00
R1654:Epha4	UTSW	1	77374768	splice site	probably null
R1755:Epha4	UTSW	1	77387823	missense	probably damaging	1.00
R1807:Epha4	UTSW	1	77374904	missense	probably benign	0.05
R2046:Epha4	UTSW	1	77507162	missense	probably damaging	1.00
R2509:Epha4	UTSW	1	77511702	missense	possibly damaging	0.84
R2511:Epha4	UTSW	1	77511702	missense	possibly damaging	0.84
R3441:Epha4	UTSW	1	77426696	missense	possibly damaging	0.90
R3724:Epha4	UTSW	1	77426543	splice site	probably benign
R3901:Epha4	UTSW	1	77380902	missense	probably damaging	1.00
R3950:Epha4	UTSW	1	77399716	missense	probably damaging	1.00
R3951:Epha4	UTSW	1	77399716	missense	probably damaging	1.00
R3952:Epha4	UTSW	1	77399716	missense	probably damaging	1.00
R4012:Epha4	UTSW	1	77390094	splice site	probably benign
R4321:Epha4	UTSW	1	77507213	critical splice acceptor site	probably null
R4422:Epha4	UTSW	1	77511717	missense	probably damaging	0.99
R4898:Epha4	UTSW	1	77390075	nonsense	probably null
R5072:Epha4	UTSW	1	77445002	missense	probably damaging	1.00
R5270:Epha4	UTSW	1	77506607	missense	probably damaging	1.00
R5281:Epha4	UTSW	1	77374867	missense	probably benign
R5315:Epha4	UTSW	1	77388472	critical splice donor site	probably null
R5531:Epha4	UTSW	1	77374876	missense	probably benign
R5621:Epha4	UTSW	1	77515049	utr 5 prime	probably benign
R5648:Epha4	UTSW	1	77398525	missense	probably benign	0.25
R5747:Epha4	UTSW	1	77506883	missense	probably damaging	0.99
R5829:Epha4	UTSW	1	77444994	missense	probably benign	0.01
R6185:Epha4	UTSW	1	77507106	missense	probably damaging	1.00
R6486:Epha4	UTSW	1	77383549	missense	probably damaging	1.00
R6821:Epha4	UTSW	1	77382945	missense	possibly damaging	0.88
R6978:Epha4	UTSW	1	77377583	missense	probably damaging	1.00
R7039:Epha4	UTSW	1	77506785	missense	probably damaging	1.00
R7216:Epha4	UTSW	1	77444984	missense	probably damaging	1.00
R7270:Epha4	UTSW	1	77399785	missense	probably damaging	1.00
R7444:Epha4	UTSW	1	77387916	missense	probably damaging	1.00
R7737:Epha4	UTSW	1	77381012	missense	probably damaging	1.00
R7763:Epha4	UTSW	1	77390031	critical splice donor site	probably null
R7950:Epha4	UTSW	1	77507196	missense	probably damaging	0.99
R8297:Epha4	UTSW	1	77506910	missense	probably damaging	1.00
R8373:Epha4	UTSW	1	77507079	missense	possibly damaging	0.60
R8429:Epha4	UTSW	1	77390036	missense	probably benign	0.08
R8907:Epha4	UTSW	1	77506785	missense	probably damaging	1.00
R9024:Epha4	UTSW	1	77388532	missense	possibly damaging	0.79
Z1088:Epha4	UTSW	1	77506662	missense	possibly damaging	0.61
Z1176:Epha4	UTSW	1	77373733	makesense	probably null
Z1176:Epha4	UTSW	1	77383011	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCATGAGAGTGCATGCCATG -3'
(R):5'- TGACTTTGCTCAGAAAGGCC -3'

Sequencing Primer
(F):5'- CATGCCATGCCAGAGGTG -3'
(R):5'- GCCCGGAAATAATGCTGAGTTTC -3'

Posted On

2014-12-04