Incidental Mutation 'R2850:Itch'
ID252048
Institutional Source Beutler Lab
Gene Symbol Itch
Ensembl Gene ENSMUSG00000027598
Gene Nameitchy, E3 ubiquitin protein ligase
Synonyms8030492O04Rik, C230047C07Rik, 6720481N21Rik, AIP4
MMRRC Submission 040443-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2850 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location155133509-155226855 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 155202221 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 482 (Q482P)
Ref Sequence ENSEMBL: ENSMUSP00000105307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029126] [ENSMUST00000109685]
Predicted Effect probably benign
Transcript: ENSMUST00000029126
AA Change: Q482P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029126
Gene: ENSMUSG00000027598
AA Change: Q482P

DomainStartEndE-ValueType
C2 19 114 3.56e-12 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 209 226 N/A INTRINSIC
low complexity region 230 259 N/A INTRINSIC
WW 288 320 1.07e-12 SMART
WW 321 352 3.86e-10 SMART
WW 400 432 7.36e-16 SMART
WW 440 472 6.82e-11 SMART
HECTc 528 864 7.04e-179 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109685
AA Change: Q482P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105307
Gene: ENSMUSG00000027598
AA Change: Q482P

DomainStartEndE-ValueType
C2 19 114 3.56e-12 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 209 226 N/A INTRINSIC
low complexity region 230 259 N/A INTRINSIC
WW 288 320 1.07e-12 SMART
WW 321 352 3.86e-10 SMART
WW 400 432 7.36e-16 SMART
WW 440 472 6.82e-11 SMART
HECTc 528 864 7.04e-179 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119431
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142147
Meta Mutation Damage Score 0.0623 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein plays a role in multiple cellular processes including erythroid and lymphoid cell differentiation and the regulation of immune responses. Mutations in this gene are a cause of syndromic multisystem autoimmune disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit increased total IgE levels in the peripheral blood and an enhanced IgE response to the cysteine protease allergen, papain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 T A 13: 12,275,179 T734S probably damaging Het
Ago1 T C 4: 126,443,075 probably benign Het
Ahi1 C T 10: 21,000,593 T801I probably benign Het
Alms1 T C 6: 85,621,299 S1505P probably benign Het
Alms1 C A 6: 85,667,963 probably benign Het
Anxa6 T A 11: 55,011,026 Y95F possibly damaging Het
Cacna1b C T 2: 24,761,788 M126I probably damaging Het
Clk1 A G 1: 58,412,279 L457S probably damaging Het
Cngb3 T C 4: 19,415,690 I400T possibly damaging Het
Cntnap5c T A 17: 58,410,348 probably benign Het
Corin A G 5: 72,304,955 V837A probably damaging Het
Ctr9 C T 7: 111,053,446 R984C unknown Het
Cubn G A 2: 13,322,953 T2687I probably damaging Het
Cypt3 T A X: 153,559,278 N168K probably damaging Het
E330020D12Rik A G 1: 153,406,590 noncoding transcript Het
Fbxl4 T C 4: 22,403,624 M399T probably benign Het
Fbxo22 T C 9: 55,223,415 F323L probably damaging Het
Fnip1 A T 11: 54,502,677 E646D probably benign Het
Gid4 G A 11: 60,438,574 probably null Het
Gnb5 A T 9: 75,327,229 D70V probably damaging Het
Gpank1 A G 17: 35,124,581 S346G probably benign Het
Gtf3c6 T C 10: 40,254,258 probably benign Het
Hdx T C X: 111,593,023 I562V probably benign Het
Ifrd2 T C 9: 107,591,709 probably benign Het
Kif11 C A 19: 37,409,493 D630E probably benign Het
Lpl G T 8: 68,899,512 E372* probably null Het
Mrps26 T C 2: 130,565,047 V198A probably benign Het
Mucl1 T C 15: 103,752,082 N201S possibly damaging Het
Nedd4 C T 9: 72,725,074 L397F possibly damaging Het
Nfat5 A G 8: 107,293,860 D12G probably damaging Het
Olfr1454 T C 19: 13,063,570 L53P probably damaging Het
Pik3r3 A G 4: 116,270,784 probably benign Het
Pkd1l3 T A 8: 109,623,990 V489E possibly damaging Het
Pkhd1 T C 1: 20,509,076 E1802G possibly damaging Het
Plb1 T A 5: 32,293,224 S370T probably benign Het
Ppat G A 5: 76,919,375 T337I probably benign Het
Prkd3 A G 17: 78,954,596 V763A possibly damaging Het
Prr9 A T 3: 92,123,169 S55T probably benign Het
Rbpms G T 8: 33,834,377 N108K possibly damaging Het
Rc3h2 A T 2: 37,377,415 D972E probably benign Het
Rrbp1 C T 2: 143,949,349 R1378Q probably benign Het
Slc26a7 T A 4: 14,593,806 probably benign Het
Stard6 T A 18: 70,483,451 H60Q probably benign Het
Sult6b2 T C 6: 142,797,887 T138A probably benign Het
Th G A 7: 142,894,075 Q329* probably null Het
Tmco3 A G 8: 13,295,024 H268R probably benign Het
Tnn T C 1: 160,139,287 D429G probably benign Het
Tnrc6a G A 7: 123,179,800 G1245R probably damaging Het
Trem3 C A 17: 48,249,641 L47M probably benign Het
Trpm6 T A 19: 18,792,090 C307S possibly damaging Het
Ube2j1 T A 4: 33,049,696 N231K probably benign Het
Urb1 A G 16: 90,774,256 Y1222H probably benign Het
Wdr81 A T 11: 75,451,172 S1090T probably damaging Het
Ythdf3 T C 3: 16,203,818 probably benign Het
Zfp280d A G 9: 72,312,089 T183A probably benign Het
Zfp354c G A 11: 50,815,331 Q306* probably null Het
Zp2 T C 7: 120,138,306 H252R probably benign Het
Other mutations in Itch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Itch APN 2 155213023 missense probably damaging 1.00
IGL00796:Itch APN 2 155209082 missense probably damaging 0.97
IGL01090:Itch APN 2 155206336 missense probably damaging 0.99
IGL01568:Itch APN 2 155212462 splice site probably benign
IGL01844:Itch APN 2 155172547 missense possibly damaging 0.56
IGL01844:Itch APN 2 155172486 missense possibly damaging 0.94
IGL01873:Itch APN 2 155168750 missense possibly damaging 0.68
IGL02129:Itch APN 2 155217988 splice site probably benign
IGL02386:Itch APN 2 155202261 nonsense probably null
IGL02545:Itch APN 2 155172586 splice site probably null
IGL02621:Itch APN 2 155172584 splice site probably null
IGL02708:Itch APN 2 155174044 missense probably benign 0.00
IGL02869:Itch APN 2 155173933 critical splice acceptor site probably null
Abrade UTSW 2 155209078 missense possibly damaging 0.93
dorsolateral UTSW 2 155210558 nonsense probably null
gadfly UTSW 2 155182298 nonsense probably null
hankerin UTSW 2 155210582 critical splice donor site probably null
prurient UTSW 2 155210502 missense probably damaging 1.00
scratch UTSW 2 155172561 missense probably damaging 0.99
R0116:Itch UTSW 2 155217983 splice site probably benign
R0207:Itch UTSW 2 155202257 missense probably benign
R0226:Itch UTSW 2 155199394 missense probably benign 0.01
R0545:Itch UTSW 2 155182298 nonsense probably null
R0689:Itch UTSW 2 155182178 missense possibly damaging 0.82
R1365:Itch UTSW 2 155213031 missense probably benign 0.00
R1406:Itch UTSW 2 155206354 missense possibly damaging 0.95
R1406:Itch UTSW 2 155206354 missense possibly damaging 0.95
R1436:Itch UTSW 2 155192145 missense probably damaging 0.96
R1639:Itch UTSW 2 155179025 splice site probably null
R1769:Itch UTSW 2 155172561 missense probably damaging 0.99
R1855:Itch UTSW 2 155172454 splice site probably benign
R1865:Itch UTSW 2 155168746 missense probably damaging 0.96
R2008:Itch UTSW 2 155210459 missense possibly damaging 0.91
R2054:Itch UTSW 2 155210576 missense probably damaging 1.00
R2196:Itch UTSW 2 155202221 missense probably benign
R2199:Itch UTSW 2 155202221 missense probably benign
R2252:Itch UTSW 2 155212339 missense probably benign 0.01
R2253:Itch UTSW 2 155212339 missense probably benign 0.01
R2348:Itch UTSW 2 155209078 missense possibly damaging 0.93
R3021:Itch UTSW 2 155209126 missense possibly damaging 0.74
R4676:Itch UTSW 2 155199435 missense probably benign 0.05
R4716:Itch UTSW 2 155210582 critical splice donor site probably null
R4888:Itch UTSW 2 155217977 splice site probably null
R4970:Itch UTSW 2 155185593 missense possibly damaging 0.50
R6029:Itch UTSW 2 155179089 critical splice donor site probably null
R6122:Itch UTSW 2 155174065 missense probably benign 0.05
R6435:Itch UTSW 2 155209129 missense probably benign 0.01
R6449:Itch UTSW 2 155163395 splice site probably benign
R7069:Itch UTSW 2 155209994 missense probably damaging 1.00
R7083:Itch UTSW 2 155210444 missense probably damaging 1.00
R7409:Itch UTSW 2 155199382 missense probably damaging 0.99
R7689:Itch UTSW 2 155210002 missense probably damaging 0.99
R7689:Itch UTSW 2 155213067 missense probably benign 0.00
R7974:Itch UTSW 2 155192159 missense probably damaging 1.00
R8046:Itch UTSW 2 155210502 missense probably damaging 1.00
R8248:Itch UTSW 2 155206383 critical splice donor site probably null
R8355:Itch UTSW 2 155210582 critical splice donor site probably null
R8428:Itch UTSW 2 155168707 missense probably benign 0.38
R8691:Itch UTSW 2 155210558 nonsense probably null
R8779:Itch UTSW 2 155172520 missense probably benign 0.28
Z1177:Itch UTSW 2 155209059 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAAATAGCCCTTAGGAAACATTC -3'
(R):5'- CTTAATCTCTGGACAACCGAAGAC -3'

Sequencing Primer
(F):5'- CACATATGCTCTACTGGGTG -3'
(R):5'- GACTCCAATGCTTCACAC -3'
Posted On2014-12-04