Mutagenetix > Incidental Mutation

Incidental Mutation 'R0311:Pkd1l3'

25205

Institutional Source

Beutler Lab

Gene Symbol

Pkd1l3

Ensembl Gene

ENSMUSG00000048827

Gene Name

polycystic kidney disease 1 like 3

Synonyms

MMRRC Submission

038521-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0311 (G1)

Quality Score

169

Status

Validated

Chromosome

Chromosomal Location

109614517-109674386 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 109623649 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 375 (D375E)

Ref Sequence

ENSEMBL: ENSMUSP00000148592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057344] [ENSMUST00000109242] [ENSMUST00000212537]

AlphaFold

Q2EG98

Predicted Effect

possibly damaging
Transcript: ENSMUST00000057344
AA Change: D375E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000051512
Gene: ENSMUSG00000048827
AA Change: D375E

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
CLECT	26	142	4.25e-1	SMART
internal_repeat_2	143	245	2.25e-8	PROSPERO
low complexity region	246	270	N/A	INTRINSIC
low complexity region	272	296	N/A	INTRINSIC
low complexity region	298	322	N/A	INTRINSIC
low complexity region	324	348	N/A	INTRINSIC
internal_repeat_1	349	431	1.22e-8	PROSPERO
internal_repeat_2	378	466	2.25e-8	PROSPERO
internal_repeat_1	518	731	1.22e-8	PROSPERO
GPS	1007	1056	3.62e-5	SMART
transmembrane domain	1075	1094	N/A	INTRINSIC
LH2	1119	1238	1.01e-9	SMART
transmembrane domain	1282	1304	N/A	INTRINSIC
transmembrane domain	1319	1341	N/A	INTRINSIC
low complexity region	1398	1408	N/A	INTRINSIC
low complexity region	1451	1460	N/A	INTRINSIC
low complexity region	1484	1497	N/A	INTRINSIC
transmembrane domain	1534	1556	N/A	INTRINSIC
transmembrane domain	1576	1595	N/A	INTRINSIC
Pfam:PKD_channel	1695	2110	2.8e-86	PFAM
Pfam:Ion_trans	1858	2114	2.9e-9	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109242
AA Change: D375E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000104865
Gene: ENSMUSG00000048827
AA Change: D375E

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
CLECT	26	142	4.25e-1	SMART
internal_repeat_2	143	245	2.63e-8	PROSPERO
low complexity region	246	270	N/A	INTRINSIC
low complexity region	272	296	N/A	INTRINSIC
low complexity region	298	322	N/A	INTRINSIC
low complexity region	324	348	N/A	INTRINSIC
internal_repeat_1	349	440	3.96e-14	PROSPERO
internal_repeat_2	378	466	2.63e-8	PROSPERO
internal_repeat_1	518	724	3.96e-14	PROSPERO
GPS	1017	1066	3.62e-5	SMART
transmembrane domain	1085	1104	N/A	INTRINSIC
LH2	1129	1248	1.01e-9	SMART
transmembrane domain	1292	1314	N/A	INTRINSIC
transmembrane domain	1329	1351	N/A	INTRINSIC
low complexity region	1408	1418	N/A	INTRINSIC
low complexity region	1461	1470	N/A	INTRINSIC
low complexity region	1494	1507	N/A	INTRINSIC
transmembrane domain	1544	1566	N/A	INTRINSIC
transmembrane domain	1586	1605	N/A	INTRINSIC
Pfam:PKD_channel	1705	2120	1.3e-86	PFAM
Pfam:Ion_trans	1868	2124	4.3e-9	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000212537
AA Change: D375E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212609

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.6%
20x: 91.6%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a latrophilin/CL-1-like GPCR proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may function as a component of cation channel pores.[provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal and exhibit normal taste responsiveness in various behavioral and electrophysiological tests of taste function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	A	C	7: 120,402,904	M1547L	probably damaging	Het
Abcb4	A	G	5: 8,934,243	K658E	probably benign	Het
Abr	A	G	11: 76,509,127	S15P	possibly damaging	Het
Adgrb2	G	C	4: 130,017,129	A1168P	probably damaging	Het
Adgre4	A	T	17: 55,802,010	E339V	probably benign	Het
Asprv1	T	C	6: 86,628,840	W223R	probably damaging	Het
Ccdc89	A	G	7: 90,426,693	E37G	probably damaging	Het
Cd48	C	A	1: 171,699,580	Y191*	probably null	Het
Chd4	T	C	6: 125,101,665	I257T	probably benign	Het
Clca4b	T	C	3: 144,932,496	M2V	probably benign	Het
Dnah11	A	T	12: 118,127,133	D1025E	probably benign	Het
Erich5	A	G	15: 34,472,939	*363W	probably null	Het
Etl4	A	G	2: 20,807,129	D1341G	probably damaging	Het
Fbxw11	A	G	11: 32,722,083	T184A	probably benign	Het
Fktn	A	G	4: 53,744,620	Q300R	probably benign	Het
G3bp1	T	C	11: 55,498,626	F383L	probably damaging	Het
Gdpd3	G	A	7: 126,767,189	R66Q	possibly damaging	Het
Hexb	A	G	13: 97,183,819		probably benign	Het
Kdm4b	A	G	17: 56,386,200	R346G	probably benign	Het
Mbtd1	T	A	11: 93,921,357		probably null	Het
Med23	T	A	10: 24,897,358	C653S	possibly damaging	Het
Nwd2	A	T	5: 63,804,998	I642L	probably damaging	Het
Olfr1444	A	G	19: 12,861,869	I31M	probably benign	Het
Olfr1448	T	A	19: 12,920,096	Y71F	possibly damaging	Het
Olfr912	T	C	9: 38,539,297	V134A	probably benign	Het
Pbld2	T	C	10: 63,054,507		probably null	Het
Plpp2	C	T	10: 79,527,580	R77K	probably damaging	Het
Pym1	G	T	10: 128,765,984	R168L	possibly damaging	Het
Rbm4	T	C	19: 4,787,556	Y300C	probably damaging	Het
Rnf207	A	G	4: 152,315,779	C175R	probably damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Speg	T	C	1: 75,430,937	V3196A	probably damaging	Het
Syne1	T	A	10: 5,348,943	I1048L	possibly damaging	Het
Th	T	C	7: 142,896,041	E41G	probably damaging	Het
Tmx4	T	A	2: 134,598,526	*336L	probably null	Het
Tnfrsf18	T	C	4: 156,026,415	V10A	possibly damaging	Het
Tnxb	A	T	17: 34,716,984	I2670F	probably damaging	Het
Tpx2	T	C	2: 152,890,492	V562A	probably damaging	Het
Vmn2r73	A	G	7: 85,871,789	S324P	probably benign	Het
Vps18	T	C	2: 119,297,365	Y890H	probably benign	Het
Ythdc1	G	A	5: 86,835,705	D670N	probably damaging	Het

Other mutations in Pkd1l3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Pkd1l3	APN	8	109630237	missense	possibly damaging	0.53
IGL00562:Pkd1l3	APN	8	109656147	missense	possibly damaging	0.53
IGL00563:Pkd1l3	APN	8	109656147	missense	possibly damaging	0.53
IGL01061:Pkd1l3	APN	8	109638706	missense	probably damaging	1.00
IGL01105:Pkd1l3	APN	8	109662241	missense	possibly damaging	0.81
IGL01574:Pkd1l3	APN	8	109623771	missense	probably benign	0.01
IGL01597:Pkd1l3	APN	8	109623521	missense	probably benign	0.33
IGL01634:Pkd1l3	APN	8	109667525	critical splice acceptor site	probably null
IGL01645:Pkd1l3	APN	8	109635302	missense	possibly damaging	0.59
IGL01770:Pkd1l3	APN	8	109648502	critical splice acceptor site	probably null
IGL01837:Pkd1l3	APN	8	109630166	missense	possibly damaging	0.85
IGL01862:Pkd1l3	APN	8	109631276	critical splice acceptor site	probably null
IGL01938:Pkd1l3	APN	8	109635301	missense	probably benign	0.00
IGL01990:Pkd1l3	APN	8	109660806	missense	probably damaging	1.00
IGL02056:Pkd1l3	APN	8	109631378	missense	probably benign	0.14
IGL02069:Pkd1l3	APN	8	109635380	missense	probably damaging	1.00
IGL02086:Pkd1l3	APN	8	109665585	missense	probably damaging	1.00
IGL02152:Pkd1l3	APN	8	109669292	missense	probably damaging	1.00
IGL02209:Pkd1l3	APN	8	109638664	missense	probably damaging	1.00
IGL02213:Pkd1l3	APN	8	109631345	missense	probably damaging	1.00
IGL02218:Pkd1l3	APN	8	109660802	missense	possibly damaging	0.92
IGL02225:Pkd1l3	APN	8	109638678	missense	probably damaging	1.00
IGL02252:Pkd1l3	APN	8	109631076	missense	possibly damaging	0.92
IGL02351:Pkd1l3	APN	8	109646497	unclassified	probably benign
IGL02358:Pkd1l3	APN	8	109646497	unclassified	probably benign
IGL02369:Pkd1l3	APN	8	109616345	missense	unknown
IGL02481:Pkd1l3	APN	8	109614782	missense	unknown
IGL02505:Pkd1l3	APN	8	109633216	missense	probably damaging	1.00
IGL02506:Pkd1l3	APN	8	109647500	missense	probably damaging	1.00
IGL02535:Pkd1l3	APN	8	109640890	nonsense	probably null
IGL02715:Pkd1l3	APN	8	109626826	missense	probably damaging	0.96
IGL02979:Pkd1l3	APN	8	109662104	splice site	probably benign
IGL03059:Pkd1l3	APN	8	109648367	missense	probably damaging	1.00
IGL03090:Pkd1l3	APN	8	109655533	nonsense	probably null
IGL03206:Pkd1l3	APN	8	109623713	missense	probably benign	0.18
IGL03328:Pkd1l3	APN	8	109662106	splice site	probably benign
BB006:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
PIT4453001:Pkd1l3	UTSW	8	109660801	missense	probably damaging	0.99
PIT4468001:Pkd1l3	UTSW	8	109664499	missense	possibly damaging	0.85
R0001:Pkd1l3	UTSW	8	109628633	splice site	probably benign
R0066:Pkd1l3	UTSW	8	109620471	missense	unknown
R0066:Pkd1l3	UTSW	8	109620471	missense	unknown
R0233:Pkd1l3	UTSW	8	109650780	nonsense	probably null
R0233:Pkd1l3	UTSW	8	109650780	nonsense	probably null
R0255:Pkd1l3	UTSW	8	109638754	missense	probably damaging	1.00
R0288:Pkd1l3	UTSW	8	109646499	splice site	probably null
R0311:Pkd1l3	UTSW	8	109623663	missense	probably benign	0.33
R0403:Pkd1l3	UTSW	8	109623649	missense	possibly damaging	0.70
R0403:Pkd1l3	UTSW	8	109623663	missense	probably benign	0.33
R0441:Pkd1l3	UTSW	8	109623649	missense	possibly damaging	0.70
R0446:Pkd1l3	UTSW	8	109623649	missense	possibly damaging	0.70
R0465:Pkd1l3	UTSW	8	109623649	missense	possibly damaging	0.70
R0465:Pkd1l3	UTSW	8	109623663	missense	probably benign	0.33
R0466:Pkd1l3	UTSW	8	109623649	missense	possibly damaging	0.70
R0467:Pkd1l3	UTSW	8	109623649	missense	possibly damaging	0.70
R0468:Pkd1l3	UTSW	8	109623649	missense	possibly damaging	0.70
R0488:Pkd1l3	UTSW	8	109623649	missense	possibly damaging	0.70
R0488:Pkd1l3	UTSW	8	109623663	missense	probably benign	0.33
R0515:Pkd1l3	UTSW	8	109623649	missense	possibly damaging	0.70
R0534:Pkd1l3	UTSW	8	109623649	missense	possibly damaging	0.70
R0650:Pkd1l3	UTSW	8	109623649	missense	possibly damaging	0.70
R0689:Pkd1l3	UTSW	8	109623649	missense	possibly damaging	0.70
R1422:Pkd1l3	UTSW	8	109621708	missense	unknown
R1464:Pkd1l3	UTSW	8	109636427	splice site	probably benign
R1467:Pkd1l3	UTSW	8	109616368	missense	unknown
R1467:Pkd1l3	UTSW	8	109616368	missense	unknown
R1469:Pkd1l3	UTSW	8	109646953	missense	possibly damaging	0.72
R1469:Pkd1l3	UTSW	8	109646953	missense	possibly damaging	0.72
R1509:Pkd1l3	UTSW	8	109640770	missense	probably damaging	0.99
R1561:Pkd1l3	UTSW	8	109614813	missense	unknown
R1574:Pkd1l3	UTSW	8	109614813	missense	unknown
R1599:Pkd1l3	UTSW	8	109636384	missense	probably benign	0.01
R1688:Pkd1l3	UTSW	8	109623818	missense	probably benign	0.18
R1792:Pkd1l3	UTSW	8	109632605	missense	probably damaging	1.00
R1818:Pkd1l3	UTSW	8	109648406	missense	probably benign	0.03
R1896:Pkd1l3	UTSW	8	109624199	missense	possibly damaging	0.92
R2105:Pkd1l3	UTSW	8	109647573	nonsense	probably null
R2185:Pkd1l3	UTSW	8	109633195	missense	possibly damaging	0.95
R2192:Pkd1l3	UTSW	8	109620524	missense	unknown
R2260:Pkd1l3	UTSW	8	109623636	missense	probably benign	0.18
R2363:Pkd1l3	UTSW	8	109628709	missense	probably benign	0.01
R2418:Pkd1l3	UTSW	8	109670721	makesense	probably null
R2435:Pkd1l3	UTSW	8	109650702	missense	probably benign	0.07
R2443:Pkd1l3	UTSW	8	109623815	missense	probably benign	0.18
R2850:Pkd1l3	UTSW	8	109623990	missense	possibly damaging	0.92
R2910:Pkd1l3	UTSW	8	109667636	splice site	probably benign
R3755:Pkd1l3	UTSW	8	109632539	missense	probably damaging	1.00
R3791:Pkd1l3	UTSW	8	109636317	missense	probably damaging	0.99
R3905:Pkd1l3	UTSW	8	109646879	missense	probably benign	0.02
R4027:Pkd1l3	UTSW	8	109623971	missense	possibly damaging	0.68
R4028:Pkd1l3	UTSW	8	109623971	missense	possibly damaging	0.68
R4029:Pkd1l3	UTSW	8	109623971	missense	possibly damaging	0.68
R4274:Pkd1l3	UTSW	8	109624119	missense	possibly damaging	0.92
R4461:Pkd1l3	UTSW	8	109632713	splice site	probably null
R4893:Pkd1l3	UTSW	8	109638394	missense	probably benign	0.15
R4907:Pkd1l3	UTSW	8	109640843	missense	probably damaging	0.99
R5037:Pkd1l3	UTSW	8	109665636	missense	probably damaging	1.00
R5045:Pkd1l3	UTSW	8	109623155	missense	unknown
R5207:Pkd1l3	UTSW	8	109633191	missense	probably damaging	1.00
R5307:Pkd1l3	UTSW	8	109640792	missense	probably damaging	1.00
R5408:Pkd1l3	UTSW	8	109667052	missense	probably damaging	1.00
R5595:Pkd1l3	UTSW	8	109655520	missense	probably damaging	1.00
R5615:Pkd1l3	UTSW	8	109630210	missense	probably benign
R5623:Pkd1l3	UTSW	8	109623719	missense	possibly damaging	0.53
R5896:Pkd1l3	UTSW	8	109626836	missense	probably damaging	1.00
R6101:Pkd1l3	UTSW	8	109640846	missense	probably damaging	1.00
R6105:Pkd1l3	UTSW	8	109640846	missense	probably damaging	1.00
R6170:Pkd1l3	UTSW	8	109623179	missense	unknown
R6330:Pkd1l3	UTSW	8	109646909	missense	probably benign	0.00
R6346:Pkd1l3	UTSW	8	109631384	missense	probably damaging	0.98
R6395:Pkd1l3	UTSW	8	109623963	missense	probably benign	0.20
R6475:Pkd1l3	UTSW	8	109623212	missense	unknown
R6480:Pkd1l3	UTSW	8	109638387	nonsense	probably null
R6519:Pkd1l3	UTSW	8	109628772	missense	probably benign
R6654:Pkd1l3	UTSW	8	109624283	missense	probably benign	0.23
R6717:Pkd1l3	UTSW	8	109614769	missense	unknown
R6733:Pkd1l3	UTSW	8	109648494	splice site	probably null
R6753:Pkd1l3	UTSW	8	109624449	missense	probably damaging	1.00
R6777:Pkd1l3	UTSW	8	109626814	missense	probably benign	0.00
R6901:Pkd1l3	UTSW	8	109614614	missense	unknown
R6975:Pkd1l3	UTSW	8	109660907	missense	possibly damaging	0.73
R6991:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R7018:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R7083:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R7139:Pkd1l3	UTSW	8	109636340	missense	probably damaging	0.96
R7153:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R7235:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R7238:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R7252:Pkd1l3	UTSW	8	109660698	missense	probably benign	0.01
R7296:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R7309:Pkd1l3	UTSW	8	109648261	splice site	probably null
R7362:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R7462:Pkd1l3	UTSW	8	109628777	missense	probably benign	0.00
R7470:Pkd1l3	UTSW	8	109638376	missense	probably benign	0.09
R7478:Pkd1l3	UTSW	8	109633315	missense	probably damaging	1.00
R7483:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R7516:Pkd1l3	UTSW	8	109635229	missense	probably damaging	1.00
R7553:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R7559:Pkd1l3	UTSW	8	109624440	missense	probably benign	0.03
R7650:Pkd1l3	UTSW	8	109672585	missense	probably benign	0.23
R7654:Pkd1l3	UTSW	8	109638417	missense	probably damaging	1.00
R7742:Pkd1l3	UTSW	8	109614572	missense	unknown
R7749:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R7751:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R7755:Pkd1l3	UTSW	8	109630166	missense	possibly damaging	0.85
R7816:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R7831:Pkd1l3	UTSW	8	109631358	missense	possibly damaging	0.47
R7835:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R7849:Pkd1l3	UTSW	8	109623788	small deletion	probably benign
R7917:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R7929:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R7952:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R8054:Pkd1l3	UTSW	8	109646376	missense	probably damaging	1.00
R8098:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R8099:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R8276:Pkd1l3	UTSW	8	109670721	makesense	probably null
R8352:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R8376:Pkd1l3	UTSW	8	109623788	small deletion	probably benign
R8377:Pkd1l3	UTSW	8	109635350	missense	probably benign	0.08
R8398:Pkd1l3	UTSW	8	109623888	missense	possibly damaging	0.93
R8399:Pkd1l3	UTSW	8	109623888	missense	possibly damaging	0.93
R8400:Pkd1l3	UTSW	8	109623888	missense	possibly damaging	0.93
R8412:Pkd1l3	UTSW	8	109633390	missense	possibly damaging	0.85
R8530:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R8539:Pkd1l3	UTSW	8	109636287	missense	probably damaging	1.00
R8546:Pkd1l3	UTSW	8	109666983	missense	possibly damaging	0.52
R8558:Pkd1l3	UTSW	8	109635380	missense	probably damaging	1.00
R8719:Pkd1l3	UTSW	8	109614623	missense	unknown
R8769:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R8797:Pkd1l3	UTSW	8	109648314	missense	probably benign	0.15
R8840:Pkd1l3	UTSW	8	109623210	missense	unknown
R8846:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R8874:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R8893:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R8956:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R8963:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R8968:Pkd1l3	UTSW	8	109623788	small deletion	probably benign
R9035:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R9054:Pkd1l3	UTSW	8	109665672	missense	probably benign	0.08
R9058:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R9119:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R9134:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R9138:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R9158:Pkd1l3	UTSW	8	109667575	nonsense	probably null
R9180:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R9181:Pkd1l3	UTSW	8	109648686	missense	probably damaging	0.98
R9218:Pkd1l3	UTSW	8	109655496	nonsense	probably null
R9249:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R9269:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R9338:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R9383:Pkd1l3	UTSW	8	109623969	small deletion	probably benign
R9396:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R9423:Pkd1l3	UTSW	8	109623680	missense	possibly damaging	0.53
R9514:Pkd1l3	UTSW	8	109669217	missense	probably damaging	1.00
R9515:Pkd1l3	UTSW	8	109669217	missense	probably damaging	1.00
R9567:Pkd1l3	UTSW	8	109667541	missense	probably damaging	0.99
R9668:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R9684:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
R9748:Pkd1l3	UTSW	8	109646923	missense	probably benign	0.00
R9778:Pkd1l3	UTSW	8	109631305	missense	probably benign	0.00
RF016:Pkd1l3	UTSW	8	109623542	missense	probably benign	0.18
RF029:Pkd1l3	UTSW	8	109624195	small deletion	probably benign
X0026:Pkd1l3	UTSW	8	109614553	missense	probably null
Z1176:Pkd1l3	UTSW	8	109623242	missense	unknown
Z31818:Pkd1l3	UTSW	8	109669292	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTGACATCAGACACACTTGCATCC -3'
(R):5'- ACCTGTGTTGGGCTGCTGAATC -3'

Sequencing Primer
(F):5'- ACTTGCATCCAGCAGCC -3'
(R):5'- GCTGCTGAATCCAGGTGTG -3'

Posted On

2013-04-16