Incidental Mutation 'R2850:Ago1'
ID252067
Institutional Source Beutler Lab
Gene Symbol Ago1
Ensembl Gene ENSMUSG00000041530
Gene Nameargonaute RISC catalytic subunit 1
SynonymsEif2c1, argonaute 1
MMRRC Submission 040443-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.654) question?
Stock #R2850 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location126435012-126468583 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 126443075 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097888] [ENSMUST00000176315]
Predicted Effect probably benign
Transcript: ENSMUST00000097888
SMART Domains Protein: ENSMUSP00000095498
Gene: ENSMUSG00000041530

DomainStartEndE-ValueType
Pfam:ArgoN 26 164 2.3e-26 PFAM
DUF1785 173 225 3.48e-25 SMART
PAZ 233 368 1.41e-5 SMART
Pfam:ArgoL2 373 418 3.6e-18 PFAM
Pfam:ArgoMid 427 509 7.6e-37 PFAM
Piwi 515 816 4.16e-131 SMART
Blast:Piwi 823 849 3e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156533
Predicted Effect probably benign
Transcript: ENSMUST00000176315
SMART Domains Protein: ENSMUSP00000134871
Gene: ENSMUSG00000041530

DomainStartEndE-ValueType
Pfam:PAZ 1 62 4.1e-23 PFAM
Piwi 211 512 4.16e-131 SMART
Blast:Piwi 519 545 2e-6 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: This gene encodes a member of the argonaute family of proteins, which associate with small RNAs and have important roles in RNA interference (RNAi) and RNA silencing. This protein binds to microRNAs (miRNAs) or small interfering RNAs (siRNAs) and represses translation of mRNAs that are complementary to them. It is also involved in transcriptional gene silencing (TGS) of promoter regions that are complementary to bound short antigene RNAs (agRNAs), as well as in the degradation of miRNA-bound mRNA targets. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target, and that its mRNA could give rise to an additional C-terminally extended isoform by use of an alternative in-frame translation termination codon. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in keratinocytes exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 T A 13: 12,275,179 T734S probably damaging Het
Ahi1 C T 10: 21,000,593 T801I probably benign Het
Alms1 T C 6: 85,621,299 S1505P probably benign Het
Alms1 C A 6: 85,667,963 probably benign Het
Anxa6 T A 11: 55,011,026 Y95F possibly damaging Het
Cacna1b C T 2: 24,761,788 M126I probably damaging Het
Clk1 A G 1: 58,412,279 L457S probably damaging Het
Cngb3 T C 4: 19,415,690 I400T possibly damaging Het
Cntnap5c T A 17: 58,410,348 probably benign Het
Corin A G 5: 72,304,955 V837A probably damaging Het
Ctr9 C T 7: 111,053,446 R984C unknown Het
Cubn G A 2: 13,322,953 T2687I probably damaging Het
Cypt3 T A X: 153,559,278 N168K probably damaging Het
E330020D12Rik A G 1: 153,406,590 noncoding transcript Het
Fbxl4 T C 4: 22,403,624 M399T probably benign Het
Fbxo22 T C 9: 55,223,415 F323L probably damaging Het
Fnip1 A T 11: 54,502,677 E646D probably benign Het
Gid4 G A 11: 60,438,574 probably null Het
Gnb5 A T 9: 75,327,229 D70V probably damaging Het
Gpank1 A G 17: 35,124,581 S346G probably benign Het
Gtf3c6 T C 10: 40,254,258 probably benign Het
Hdx T C X: 111,593,023 I562V probably benign Het
Ifrd2 T C 9: 107,591,709 probably benign Het
Itch A C 2: 155,202,221 Q482P probably benign Het
Kif11 C A 19: 37,409,493 D630E probably benign Het
Lpl G T 8: 68,899,512 E372* probably null Het
Mrps26 T C 2: 130,565,047 V198A probably benign Het
Mucl1 T C 15: 103,752,082 N201S possibly damaging Het
Nedd4 C T 9: 72,725,074 L397F possibly damaging Het
Nfat5 A G 8: 107,293,860 D12G probably damaging Het
Olfr1454 T C 19: 13,063,570 L53P probably damaging Het
Pik3r3 A G 4: 116,270,784 probably benign Het
Pkd1l3 T A 8: 109,623,990 V489E possibly damaging Het
Pkhd1 T C 1: 20,509,076 E1802G possibly damaging Het
Plb1 T A 5: 32,293,224 S370T probably benign Het
Ppat G A 5: 76,919,375 T337I probably benign Het
Prkd3 A G 17: 78,954,596 V763A possibly damaging Het
Prr9 A T 3: 92,123,169 S55T probably benign Het
Rbpms G T 8: 33,834,377 N108K possibly damaging Het
Rc3h2 A T 2: 37,377,415 D972E probably benign Het
Rrbp1 C T 2: 143,949,349 R1378Q probably benign Het
Slc26a7 T A 4: 14,593,806 probably benign Het
Stard6 T A 18: 70,483,451 H60Q probably benign Het
Sult6b2 T C 6: 142,797,887 T138A probably benign Het
Th G A 7: 142,894,075 Q329* probably null Het
Tmco3 A G 8: 13,295,024 H268R probably benign Het
Tnn T C 1: 160,139,287 D429G probably benign Het
Tnrc6a G A 7: 123,179,800 G1245R probably damaging Het
Trem3 C A 17: 48,249,641 L47M probably benign Het
Trpm6 T A 19: 18,792,090 C307S possibly damaging Het
Ube2j1 T A 4: 33,049,696 N231K probably benign Het
Urb1 A G 16: 90,774,256 Y1222H probably benign Het
Wdr81 A T 11: 75,451,172 S1090T probably damaging Het
Ythdf3 T C 3: 16,203,818 probably benign Het
Zfp280d A G 9: 72,312,089 T183A probably benign Het
Zfp354c G A 11: 50,815,331 Q306* probably null Het
Zp2 T C 7: 120,138,306 H252R probably benign Het
Other mutations in Ago1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Ago1 APN 4 126459817 missense probably damaging 0.98
IGL02578:Ago1 APN 4 126439531 missense probably benign 0.12
IGL02709:Ago1 APN 4 126453640 nonsense probably null
IGL02810:Ago1 APN 4 126443093 missense probably benign 0.00
IGL03037:Ago1 APN 4 126461794 missense probably benign 0.00
IGL03091:Ago1 APN 4 126459189 missense probably damaging 0.98
IGL03100:Ago1 APN 4 126443171 missense probably benign 0.08
IGL03121:Ago1 APN 4 126460003 missense probably benign 0.00
R0195:Ago1 UTSW 4 126463691 missense probably benign 0.01
R0244:Ago1 UTSW 4 126463706 missense possibly damaging 0.94
R0309:Ago1 UTSW 4 126443166 missense probably benign 0.06
R0514:Ago1 UTSW 4 126439595 missense probably benign
R0557:Ago1 UTSW 4 126460024 missense probably benign 0.00
R1104:Ago1 UTSW 4 126453633 missense probably damaging 0.99
R1553:Ago1 UTSW 4 126440401 missense probably damaging 0.99
R1624:Ago1 UTSW 4 126463741 missense probably damaging 0.97
R1851:Ago1 UTSW 4 126439995 missense probably benign 0.00
R1867:Ago1 UTSW 4 126441236 missense probably damaging 0.98
R2001:Ago1 UTSW 4 126454394 missense probably null 0.36
R2051:Ago1 UTSW 4 126460453 missense probably benign 0.01
R2057:Ago1 UTSW 4 126443228 missense probably damaging 0.98
R2105:Ago1 UTSW 4 126461788 missense probably benign 0.30
R2117:Ago1 UTSW 4 126463857 unclassified probably null
R2256:Ago1 UTSW 4 126441911 missense possibly damaging 0.80
R2272:Ago1 UTSW 4 126453650 missense probably benign 0.01
R2517:Ago1 UTSW 4 126439939 nonsense probably null
R2993:Ago1 UTSW 4 126440046 splice site probably benign
R3746:Ago1 UTSW 4 126461044 missense probably benign
R3747:Ago1 UTSW 4 126461044 missense probably benign
R3750:Ago1 UTSW 4 126461044 missense probably benign
R4600:Ago1 UTSW 4 126460392 missense probably benign 0.37
R4934:Ago1 UTSW 4 126448859 missense possibly damaging 0.56
R4983:Ago1 UTSW 4 126453654 missense probably damaging 0.99
R5086:Ago1 UTSW 4 126453604 missense probably benign 0.01
R5132:Ago1 UTSW 4 126461723 missense probably benign 0.01
R5239:Ago1 UTSW 4 126441215 missense probably damaging 1.00
R5609:Ago1 UTSW 4 126461037 missense possibly damaging 0.80
R5705:Ago1 UTSW 4 126448794 missense probably benign 0.01
R5980:Ago1 UTSW 4 126460569 unclassified probably benign
R6036:Ago1 UTSW 4 126443228 missense probably damaging 0.98
R6036:Ago1 UTSW 4 126443228 missense probably damaging 0.98
R6398:Ago1 UTSW 4 126448808 missense probably benign 0.26
R6505:Ago1 UTSW 4 126463835 missense probably benign 0.00
R6545:Ago1 UTSW 4 126454352 missense possibly damaging 0.74
R6944:Ago1 UTSW 4 126460422 missense possibly damaging 0.78
R7041:Ago1 UTSW 4 126463706 missense possibly damaging 0.94
R7490:Ago1 UTSW 4 126439505 makesense probably null
R7496:Ago1 UTSW 4 126461752 missense probably benign 0.20
R7575:Ago1 UTSW 4 126453908 missense probably benign 0.12
R7625:Ago1 UTSW 4 126443229 missense probably benign 0.18
R8041:Ago1 UTSW 4 126441936 missense probably damaging 1.00
R8073:Ago1 UTSW 4 126443226 missense probably benign 0.04
X0025:Ago1 UTSW 4 126443115 missense possibly damaging 0.47
Z1177:Ago1 UTSW 4 126453656 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTGTAACATCTGCTCCCAGG -3'
(R):5'- CTCTCTTCCCATAGCTGAAGTG -3'

Sequencing Primer
(F):5'- CCCAGGAAAATCACTGGCTGTTG -3'
(R):5'- CTTCCCATAGCTGAAGTGAAACGTG -3'
Posted On2014-12-04