Mutagenetix > Incidental Mutation

Incidental Mutation 'R0311:Olfr912'

25207

Institutional Source

Beutler Lab

Gene Symbol

Olfr912

Ensembl Gene

ENSMUSG00000111448

Gene Name

olfactory receptor 912

Synonyms

MOR165-4, GA_x6K02T2PVTD-32283590-32284522

MMRRC Submission

038521-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.232) question?

Stock #

R0311 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

38580178-38586876 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 38539297 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 134 (V134A)

Ref Sequence

ENSEMBL: ENSMUSP00000149263 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000215122]

AlphaFold

A0A1L1SSS5

Predicted Effect

probably benign
Transcript: ENSMUST00000073214
AA Change: V134A

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000072947
Gene: ENSMUSG00000057444
AA Change: V134A

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	2.9e-49	PFAM
Pfam:7tm_1	41	290	4.2e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000215122
AA Change: V134A

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.6%
20x: 91.6%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	A	C	7: 120,402,904	M1547L	probably damaging	Het
Abcb4	A	G	5: 8,934,243	K658E	probably benign	Het
Abr	A	G	11: 76,509,127	S15P	possibly damaging	Het
Adgrb2	G	C	4: 130,017,129	A1168P	probably damaging	Het
Adgre4	A	T	17: 55,802,010	E339V	probably benign	Het
Asprv1	T	C	6: 86,628,840	W223R	probably damaging	Het
Ccdc89	A	G	7: 90,426,693	E37G	probably damaging	Het
Cd48	C	A	1: 171,699,580	Y191*	probably null	Het
Chd4	T	C	6: 125,101,665	I257T	probably benign	Het
Clca4b	T	C	3: 144,932,496	M2V	probably benign	Het
Dnah11	A	T	12: 118,127,133	D1025E	probably benign	Het
Erich5	A	G	15: 34,472,939	*363W	probably null	Het
Etl4	A	G	2: 20,807,129	D1341G	probably damaging	Het
Fbxw11	A	G	11: 32,722,083	T184A	probably benign	Het
Fktn	A	G	4: 53,744,620	Q300R	probably benign	Het
G3bp1	T	C	11: 55,498,626	F383L	probably damaging	Het
Gdpd3	G	A	7: 126,767,189	R66Q	possibly damaging	Het
Hexb	A	G	13: 97,183,819		probably benign	Het
Kdm4b	A	G	17: 56,386,200	R346G	probably benign	Het
Mbtd1	T	A	11: 93,921,357		probably null	Het
Med23	T	A	10: 24,897,358	C653S	possibly damaging	Het
Nwd2	A	T	5: 63,804,998	I642L	probably damaging	Het
Olfr1444	A	G	19: 12,861,869	I31M	probably benign	Het
Olfr1448	T	A	19: 12,920,096	Y71F	possibly damaging	Het
Pbld2	T	C	10: 63,054,507		probably null	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Pkd1l3	G	A	8: 109,623,663	S380N	probably benign	Het
Plpp2	C	T	10: 79,527,580	R77K	probably damaging	Het
Pym1	G	T	10: 128,765,984	R168L	possibly damaging	Het
Rbm4	T	C	19: 4,787,556	Y300C	probably damaging	Het
Rnf207	A	G	4: 152,315,779	C175R	probably damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Speg	T	C	1: 75,430,937	V3196A	probably damaging	Het
Syne1	T	A	10: 5,348,943	I1048L	possibly damaging	Het
Th	T	C	7: 142,896,041	E41G	probably damaging	Het
Tmx4	T	A	2: 134,598,526	*336L	probably null	Het
Tnfrsf18	T	C	4: 156,026,415	V10A	possibly damaging	Het
Tnxb	A	T	17: 34,716,984	I2670F	probably damaging	Het
Tpx2	T	C	2: 152,890,492	V562A	probably damaging	Het
Vmn2r73	A	G	7: 85,871,789	S324P	probably benign	Het
Vps18	T	C	2: 119,297,365	Y890H	probably benign	Het
Ythdc1	G	A	5: 86,835,705	D670N	probably damaging	Het

Other mutations in Olfr912

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00913:Olfr912	APN	9	38581376	missense	probably damaging	0.97
IGL01099:Olfr912	APN	9	38582077	missense	probably benign	0.00
IGL01749:Olfr912	APN	9	38581513	missense	probably damaging	1.00
IGL01750:Olfr912	APN	9	38581513	missense	probably damaging	1.00
IGL01751:Olfr912	APN	9	38581513	missense	probably damaging	1.00
IGL01752:Olfr912	APN	9	38581513	missense	probably damaging	1.00
IGL01753:Olfr912	APN	9	38581513	missense	probably damaging	1.00
IGL02262:Olfr912	APN	9	38581513	missense	probably damaging	1.00
IGL02264:Olfr912	APN	9	38581513	missense	probably damaging	1.00
IGL02298:Olfr912	APN	9	38581513	missense	probably damaging	1.00
IGL02305:Olfr912	APN	9	38581513	missense	probably damaging	1.00
IGL02309:Olfr912	APN	9	38581433	missense	probably damaging	1.00
IGL02309:Olfr912	APN	9	38581513	missense	probably damaging	1.00
IGL02317:Olfr912	APN	9	38581513	missense	probably damaging	1.00
IGL02401:Olfr912	APN	9	38581355	missense	probably damaging	1.00
R0973:Olfr912	UTSW	9	38581283	missense	possibly damaging	0.74
R1552:Olfr912	UTSW	9	38581379	missense	probably benign	0.00
R1720:Olfr912	UTSW	9	38581289	missense	probably benign
R2149:Olfr912	UTSW	9	38581508	missense	probably benign	0.02
R2241:Olfr912	UTSW	9	38581805	missense	probably damaging	1.00
R3622:Olfr912	UTSW	9	38581496	missense	probably damaging	1.00
R4384:Olfr912	UTSW	9	38582053	missense	probably damaging	1.00
R4686:Olfr912	UTSW	9	38582031	missense	probably damaging	1.00
R4780:Olfr912	UTSW	9	38581969	missense	possibly damaging	0.84
R5221:Olfr912	UTSW	9	38581852	missense	probably damaging	1.00
R5503:Olfr912	UTSW	9	38582072	missense	probably benign
R5887:Olfr912	UTSW	9	38581784	missense	probably damaging	1.00
R6062:Olfr912	UTSW	9	38539144	missense	probably damaging	0.97
R6516:Olfr912	UTSW	9	38581472	missense	probably damaging	1.00
R6542:Olfr912	UTSW	9	38539437	missense	probably benign	0.01
R6766:Olfr912	UTSW	9	38581773	missense	probably damaging	1.00
R7057:Olfr912	UTSW	9	38581754	missense	probably damaging	1.00
R7112:Olfr912	UTSW	9	38582034	nonsense	probably null
R7414:Olfr912	UTSW	9	38581468	missense	probably benign	0.00
R7514:Olfr912	UTSW	9	38582051	missense	probably damaging	0.96
R7915:Olfr912	UTSW	9	38581673	missense	probably damaging	1.00
R9205:Olfr912	UTSW	9	38582077	missense	probably benign	0.00
R9290:Olfr912	UTSW	9	38582038	missense	probably damaging	1.00
R9626:Olfr912	UTSW	9	38581681	missense	probably benign
Z1176:Olfr912	UTSW	9	38581885	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GATTATCAGGCATTCCCACCACAGG -3'
(R):5'- AGCTGCATCAAAGGCAGAAGATCAC -3'

Sequencing Primer
(F):5'- AACTGCCTTTGGGAATTTGACC -3'
(R):5'- CACAGAAGTAGTGATTGATGGTGTTC -3'

Posted On

2013-04-16