Mutagenetix > Incidental Mutation

Incidental Mutation 'R2504:Celsr2'

252095

Institutional Source

Beutler Lab

Gene Symbol

Celsr2

Ensembl Gene

ENSMUSG00000068740

Gene Name

cadherin, EGF LAG seven-pass G-type receptor 2

Synonyms

mfmi1, EGFL2, flamingo

MMRRC Submission

040412-MU

Accession Numbers

Genbank: NM_017392.3, NM_001004177.2 ; Ensembl: ENSMUST00000090558

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2504 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

108390851-108415552 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 108413591 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 635 (V635E)

Ref Sequence

ENSEMBL: ENSMUSP00000088046 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090558]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000090558
AA Change: V635E

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000088046
Gene: ENSMUSG00000068740
AA Change: V635E

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
low complexity region	35	53	N/A	INTRINSIC
CA	203	287	1.36e-26	SMART
CA	311	397	1.33e-29	SMART
CA	421	503	2.59e-27	SMART
CA	527	608	3.33e-30	SMART
CA	632	710	5.18e-18	SMART
CA	734	813	1.08e-29	SMART
CA	837	919	8.08e-29	SMART
low complexity region	920	932	N/A	INTRINSIC
CA	943	1021	4.3e-24	SMART
CA	1049	1125	1.87e-1	SMART
low complexity region	1188	1198	N/A	INTRINSIC
EGF	1231	1286	1.81e-3	SMART
EGF_CA	1288	1324	2.24e-8	SMART
EGF	1331	1366	6.65e-2	SMART
LamG	1387	1554	8.4e-30	SMART
EGF	1577	1610	8e-5	SMART
LamG	1636	1770	1.56e-24	SMART
EGF	1796	1829	2.35e-2	SMART
EGF	1831	1867	3.88e-3	SMART
TNFR	1908	1943	1.35e-1	SMART
EGF_Lam	1924	1969	9.54e-12	SMART
HormR	1972	2034	1.57e-20	SMART
Pfam:GAIN	2046	2289	3e-62	PFAM
GPS	2315	2368	1.86e-25	SMART
Pfam:7tm_2	2373	2605	1.1e-48	PFAM
low complexity region	2715	2733	N/A	INTRINSIC
low complexity region	2857	2873	N/A	INTRINSIC
low complexity region	2874	2881	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. The specific function of this particular member has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this allele have mild to moderately dilated lateral ventricles in the brain but are otherwise normal. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(3)

Other mutations in this stock

Total: 113 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	G	A	15: 8,219,216	E1750K	probably damaging	Het
4933425L06Rik	A	G	13: 105,109,742	I270M	probably benign	Het
Aatk	T	C	11: 120,018,855	D28G	probably benign	Het
Abcg1	T	A	17: 31,092,395	S125T	probably damaging	Het
Actbl2	T	C	13: 111,256,183	S351P	possibly damaging	Het
Ankrd34b	A	G	13: 92,439,061		probably null	Het
BC030867	T	C	11: 102,255,296	Y133H	possibly damaging	Het
BC051665	C	T	13: 60,782,654	V295I	probably benign	Het
C1qtnf2	A	G	11: 43,491,156	N265S	probably damaging	Het
Ccdc14	C	T	16: 34,721,850	R573*	probably null	Het
Cd55b	A	T	1: 130,409,875	Y247N	probably damaging	Het
Clec16a	T	C	16: 10,559,687		probably benign	Het
Clec4b1	A	G	6: 123,065,945	Y41C	probably damaging	Het
Cntn5	A	T	9: 10,172,121	D19E	probably benign	Het
Cop1	A	G	1: 159,232,805	N53S	probably damaging	Het
Csad	A	T	15: 102,188,667	M1K	probably null	Het
Cyb5rl	A	G	4: 107,080,945	I200V	probably benign	Het
Cyp26a1	A	G	19: 37,698,342	T81A	probably damaging	Het
Cyp2d12	A	T	15: 82,559,036	H433L	probably benign	Het
D7Ertd443e	T	A	7: 134,349,479		probably null	Het
Dennd1b	A	G	1: 139,170,170		probably benign	Het
Dmap1	G	T	4: 117,675,298	T357K	probably damaging	Het
Dzip1	G	T	14: 118,881,044	T759K	probably benign	Het
Elmo2	A	G	2: 165,298,687	V300A	probably damaging	Het
Eml5	T	C	12: 98,844,105	D864G	possibly damaging	Het
Ep400	A	G	5: 110,668,645	V2670A	probably damaging	Het
Epha3	T	A	16: 63,603,625	I534F	probably damaging	Het
Epha4	A	C	1: 77,382,991	Y742D	probably damaging	Het
Ergic2	A	G	6: 148,204,774		probably null	Het
Ero1l	A	T	14: 45,299,088		probably null	Het
Fam229a	A	G	4: 129,491,486	D70G	probably damaging	Het
Fbn2	C	T	18: 58,093,359	R781Q	probably damaging	Het
Fbxo16	A	T	14: 65,270,714		probably benign	Het
Fbxo39	T	A	11: 72,317,285	S154R	probably benign	Het
Fer	T	A	17: 63,991,580		probably null	Het
Filip1l	A	G	16: 57,570,662	I538V	possibly damaging	Het
Filip1l	A	T	16: 57,571,047	D428V	probably damaging	Het
Fsip2	T	C	2: 82,979,610	I2091T	possibly damaging	Het
Glyat	A	C	19: 12,651,398	T186P	possibly damaging	Het
Gm10604	A	G	4: 11,980,083	S74P	unknown	Het
Gm4787	T	G	12: 81,379,137	K82N	possibly damaging	Het
Hectd4	T	C	5: 121,220,620	I50T	unknown	Het
Hectd4	T	C	5: 121,263,967	S373P	possibly damaging	Het
Hmcn1	A	T	1: 150,686,867	C2313*	probably null	Het
Igfn1	A	T	1: 135,969,316	S1171T	probably benign	Het
Ints8	T	C	4: 11,241,642	D267G	probably benign	Het
Itln1	A	G	1: 171,529,159	C251R	probably damaging	Het
Jcad	C	T	18: 4,674,026	T596M	probably damaging	Het
Kcnj16	C	T	11: 111,025,583	T357M	probably benign	Het
Kif13a	G	A	13: 46,814,200	T346M	probably damaging	Het
Klhl24	G	A	16: 20,120,167	A491T	probably benign	Het
Kntc1	C	T	5: 123,778,347	Q748*	probably null	Het
Krt25	T	A	11: 99,317,296	K369*	probably null	Het
Krt75	C	T	15: 101,568,031	R433Q	probably benign	Het
Krt76	A	G	15: 101,884,858	F582L	unknown	Het
Lysmd1	G	A	3: 95,138,397	V182I	probably benign	Het
Mab21l2	T	A	3: 86,547,555	E46V	probably damaging	Het
Magi2	A	T	5: 20,358,936	K355N	probably damaging	Het
March10	T	C	11: 105,385,572	D630G	probably damaging	Het
Mast4	A	T	13: 102,738,639	I1215N	probably damaging	Het
Nckap1	G	A	2: 80,530,218	T523I	probably benign	Het
Nexmif	T	A	X: 104,084,393	D1306V	probably damaging	Het
Nfkb1	A	C	3: 135,589,329	I918R	possibly damaging	Het
Nup50	A	T	15: 84,933,658	T93S	probably benign	Het
Nwd2	T	C	5: 63,804,374	Y434H	probably benign	Het
Olfr61	T	C	7: 140,638,484	V261A	probably benign	Het
Osbpl1a	C	A	18: 12,905,031	V288L	probably benign	Het
Pan3	A	G	5: 147,527,036	E562G	possibly damaging	Het
Pappa	T	A	4: 65,180,889	Y548*	probably null	Het
Phf3	A	T	1: 30,810,789	L1181Q	probably damaging	Het
Phip	T	C	9: 82,915,339	H537R	possibly damaging	Het
Pkhd1l1	T	C	15: 44,485,428	I240T	probably damaging	Het
Pole	G	A	5: 110,290,502		probably null	Het
Polq	T	A	16: 37,011,942	S15T	unknown	Het
Prrt2	T	C	7: 127,020,224	E23G	possibly damaging	Het
Prss37	A	T	6: 40,517,826		probably null	Het
Prune2	T	C	19: 17,000,036	L45P	probably damaging	Het
Psd	A	T	19: 46,324,913	M6K	possibly damaging	Het
Psmd1	A	G	1: 86,089,997	E510G	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Pxdn	T	A	12: 30,003,406	I1194N	probably damaging	Het
Rbp3	C	T	14: 33,956,018	T641M	probably damaging	Het
Rgmb	C	A	17: 15,807,647	R270L	probably benign	Het
Rpgrip1l	A	G	8: 91,280,716		probably null	Het
Rps2	G	A	17: 24,720,379		probably benign	Het
Rsbn1l	G	T	5: 20,902,366	A550E	probably damaging	Het
S1pr4	C	T	10: 81,499,304	R112H	probably benign	Het
Scfd2	T	C	5: 74,531,177	N148S	probably damaging	Het
Scin	C	T	12: 40,081,706	M276I	probably benign	Het
Sec24d	T	C	3: 123,353,606	I708T	possibly damaging	Het
Skint11	T	A	4: 114,228,812	F41I	possibly damaging	Het
Slc15a4	A	T	5: 127,617,239	F44Y	possibly damaging	Het
Slc6a18	A	G	13: 73,675,806	Y72H	probably benign	Het
Slc7a11	A	T	3: 50,377,746		probably null	Het
Slc7a14	G	T	3: 31,237,501	N209K	possibly damaging	Het
Sstr2	T	C	11: 113,624,431	C59R	probably damaging	Het
Stab1	A	G	14: 31,163,040		probably null	Het
Stag1	G	T	9: 100,866,210	S475I	probably damaging	Het
Stxbp5l	A	G	16: 37,115,667	Y1183H	probably damaging	Het
Svep1	A	T	4: 58,135,628		probably null	Het
Tm9sf2	A	G	14: 122,158,684	T653A	probably benign	Het
Tmeff1	T	C	4: 48,662,059	S366P	possibly damaging	Het
Tnnt2	G	T	1: 135,852,065	W300L	probably damaging	Het
Traj32	A	G	14: 54,186,103		probably benign	Het
Trp53bp2	A	T	1: 182,441,639	M223L	probably benign	Het
Tsga10	G	A	1: 37,815,677	T246M	probably damaging	Het
Txn2	A	T	15: 77,926,670		probably benign	Het
Ubr3	T	A	2: 69,938,198	F450I	probably damaging	Het
Usp47	T	C	7: 112,104,470		probably null	Het
Vars2	C	T	17: 35,664,793	R244Q	probably damaging	Het
Xrra1	T	A	7: 99,897,596	F251L	probably damaging	Het
Zfp804a	G	A	2: 82,257,519	R564Q	probably benign	Het
Zfp983	T	C	17: 21,658,967	C29R	probably damaging	Het

Other mutations in Celsr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Celsr2	APN	3	108413879	missense	possibly damaging	0.49
IGL01020:Celsr2	APN	3	108403270	missense	probably damaging	0.99
IGL01420:Celsr2	APN	3	108393763	missense	probably benign	0.13
IGL01448:Celsr2	APN	3	108393239	missense	probably damaging	0.99
IGL01559:Celsr2	APN	3	108406867	missense	possibly damaging	0.75
IGL01674:Celsr2	APN	3	108414843	missense	probably damaging	1.00
IGL01863:Celsr2	APN	3	108394022	missense	probably benign	0.00
IGL02309:Celsr2	APN	3	108396011	missense	probably damaging	1.00
IGL02325:Celsr2	APN	3	108412871	missense	probably damaging	1.00
IGL02409:Celsr2	APN	3	108413955	missense	probably damaging	1.00
IGL02514:Celsr2	APN	3	108397510	missense	probably benign	0.01
IGL02812:Celsr2	APN	3	108414113	missense	probably benign	0.25
IGL02894:Celsr2	APN	3	108395210	missense	probably damaging	1.00
IGL03281:Celsr2	APN	3	108412940	missense	probably damaging	1.00
barrow	UTSW	3	108394965	missense	possibly damaging	0.92
goldeneye	UTSW	3	108394919	missense	probably damaging	1.00
1mM(1):Celsr2	UTSW	3	108400838	missense	probably benign	0.01
ANU74:Celsr2	UTSW	3	108412499	missense	probably damaging	1.00
IGL02799:Celsr2	UTSW	3	108414062	missense	probably damaging	1.00
R0011:Celsr2	UTSW	3	108413402	missense	probably benign	0.19
R0031:Celsr2	UTSW	3	108413063	missense	probably damaging	1.00
R0049:Celsr2	UTSW	3	108397254	missense	probably benign	0.12
R0049:Celsr2	UTSW	3	108397254	missense	probably benign	0.12
R0090:Celsr2	UTSW	3	108393327	splice site	probably benign
R0140:Celsr2	UTSW	3	108397933	missense	probably benign	0.00
R0524:Celsr2	UTSW	3	108401587	missense	probably damaging	1.00
R0607:Celsr2	UTSW	3	108403895	critical splice donor site	probably null
R0662:Celsr2	UTSW	3	108398520	missense	probably damaging	0.99
R0690:Celsr2	UTSW	3	108414977	missense	probably damaging	1.00
R0691:Celsr2	UTSW	3	108412623	missense	probably damaging	1.00
R0710:Celsr2	UTSW	3	108412712	missense	probably benign	0.42
R0730:Celsr2	UTSW	3	108398606	missense	probably damaging	1.00
R0815:Celsr2	UTSW	3	108401301	missense	possibly damaging	0.56
R0848:Celsr2	UTSW	3	108414338	missense	probably benign
R0989:Celsr2	UTSW	3	108403272	missense	probably benign	0.00
R1185:Celsr2	UTSW	3	108399709	missense	possibly damaging	0.95
R1185:Celsr2	UTSW	3	108399709	missense	possibly damaging	0.95
R1185:Celsr2	UTSW	3	108399709	missense	possibly damaging	0.95
R1469:Celsr2	UTSW	3	108414108	missense	probably damaging	1.00
R1469:Celsr2	UTSW	3	108414108	missense	probably damaging	1.00
R1474:Celsr2	UTSW	3	108393739	missense	possibly damaging	0.91
R1608:Celsr2	UTSW	3	108402483	missense	probably damaging	1.00
R1653:Celsr2	UTSW	3	108413520	missense	possibly damaging	0.52
R1659:Celsr2	UTSW	3	108414095	missense	probably benign
R1689:Celsr2	UTSW	3	108407304	missense	possibly damaging	0.63
R1848:Celsr2	UTSW	3	108401310	missense	probably benign	0.35
R1859:Celsr2	UTSW	3	108396630	missense	probably damaging	1.00
R1918:Celsr2	UTSW	3	108398650	missense	probably benign	0.05
R1974:Celsr2	UTSW	3	108414214	missense	probably damaging	1.00
R2042:Celsr2	UTSW	3	108402495	missense	probably damaging	0.98
R2167:Celsr2	UTSW	3	108413193	missense	probably damaging	0.96
R2333:Celsr2	UTSW	3	108398605	missense	probably benign	0.16
R2434:Celsr2	UTSW	3	108404479	missense	probably damaging	1.00
R3420:Celsr2	UTSW	3	108414416	missense	probably benign	0.03
R3712:Celsr2	UTSW	3	108400839	missense	probably benign
R3723:Celsr2	UTSW	3	108397415	splice site	probably benign
R3809:Celsr2	UTSW	3	108403239	missense	possibly damaging	0.67
R4018:Celsr2	UTSW	3	108394965	missense	possibly damaging	0.92
R4126:Celsr2	UTSW	3	108402097	missense	possibly damaging	0.71
R4177:Celsr2	UTSW	3	108413978	missense	probably damaging	0.96
R4232:Celsr2	UTSW	3	108413772	missense	probably benign	0.02
R4293:Celsr2	UTSW	3	108393677	missense	probably benign	0.01
R4458:Celsr2	UTSW	3	108394997	missense	probably damaging	0.98
R4621:Celsr2	UTSW	3	108395216	missense	possibly damaging	0.86
R4645:Celsr2	UTSW	3	108395969	missense	probably damaging	1.00
R4700:Celsr2	UTSW	3	108397231	missense	probably benign	0.24
R4732:Celsr2	UTSW	3	108398952	missense	probably damaging	0.99
R4733:Celsr2	UTSW	3	108398952	missense	probably damaging	0.99
R4901:Celsr2	UTSW	3	108406987	missense	possibly damaging	0.81
R4932:Celsr2	UTSW	3	108402758	missense	probably damaging	1.00
R4989:Celsr2	UTSW	3	108412629	missense	possibly damaging	0.62
R5052:Celsr2	UTSW	3	108412358	missense	probably damaging	1.00
R5093:Celsr2	UTSW	3	108413373	missense	possibly damaging	0.66
R5114:Celsr2	UTSW	3	108393996	missense	probably benign	0.05
R5120:Celsr2	UTSW	3	108393120	missense	probably benign	0.02
R5135:Celsr2	UTSW	3	108398659	missense	probably damaging	1.00
R5247:Celsr2	UTSW	3	108397630	missense	probably benign	0.34
R5381:Celsr2	UTSW	3	108402757	missense	probably damaging	1.00
R5412:Celsr2	UTSW	3	108399995	missense	probably damaging	1.00
R5445:Celsr2	UTSW	3	108392658	missense	probably benign	0.01
R5528:Celsr2	UTSW	3	108413294	missense	probably damaging	1.00
R5598:Celsr2	UTSW	3	108402803	missense	possibly damaging	0.82
R5652:Celsr2	UTSW	3	108396735	missense	probably null	0.49
R5697:Celsr2	UTSW	3	108403921	nonsense	probably null
R5718:Celsr2	UTSW	3	108393358	missense	probably benign
R5869:Celsr2	UTSW	3	108413909	missense	probably damaging	1.00
R5876:Celsr2	UTSW	3	108413943	missense	probably damaging	0.96
R6021:Celsr2	UTSW	3	108401245	missense	probably benign
R6054:Celsr2	UTSW	3	108406963	missense	possibly damaging	0.95
R6244:Celsr2	UTSW	3	108393128	missense	probably damaging	0.96
R6313:Celsr2	UTSW	3	108401214	missense	probably damaging	0.99
R6322:Celsr2	UTSW	3	108412574	missense	probably damaging	1.00
R6555:Celsr2	UTSW	3	108394919	missense	probably damaging	1.00
R6682:Celsr2	UTSW	3	108400501	critical splice donor site	probably null
R7062:Celsr2	UTSW	3	108402510	missense	possibly damaging	0.95
R7110:Celsr2	UTSW	3	108397865	missense	probably damaging	1.00
R7139:Celsr2	UTSW	3	108415359	missense	unknown
R7326:Celsr2	UTSW	3	108394995	missense	possibly damaging	0.85
R7425:Celsr2	UTSW	3	108402457	missense	probably damaging	1.00
R7452:Celsr2	UTSW	3	108413090	missense	possibly damaging	0.95
R7461:Celsr2	UTSW	3	108395640	missense	probably damaging	1.00
R7502:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R7613:Celsr2	UTSW	3	108395640	missense	probably damaging	1.00
R7644:Celsr2	UTSW	3	108413490	missense	probably damaging	0.99
R7666:Celsr2	UTSW	3	108398588	missense	probably benign
R7687:Celsr2	UTSW	3	108397769	missense	probably benign	0.27
R7695:Celsr2	UTSW	3	108402753	missense	probably damaging	1.00
R8002:Celsr2	UTSW	3	108403969	missense	probably damaging	1.00
R8052:Celsr2	UTSW	3	108412655	missense	probably damaging	1.00
R8283:Celsr2	UTSW	3	108396455	missense	probably damaging	1.00
R8356:Celsr2	UTSW	3	108413531	missense	possibly damaging	0.90
R8381:Celsr2	UTSW	3	108395636	missense	probably damaging	1.00
R8427:Celsr2	UTSW	3	108392633	makesense	probably null
R8435:Celsr2	UTSW	3	108414399	missense	probably benign
R8438:Celsr2	UTSW	3	108393823	missense	probably damaging	1.00
R8458:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R8460:Celsr2	UTSW	3	108396777	missense	possibly damaging	0.84
R8462:Celsr2	UTSW	3	108412851	nonsense	probably null
R8479:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R8480:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R8512:Celsr2	UTSW	3	108413838	missense	probably damaging	1.00
R8694:Celsr2	UTSW	3	108406860	missense	probably damaging	1.00
R8772:Celsr2	UTSW	3	108397073	missense	possibly damaging	0.84
R8843:Celsr2	UTSW	3	108396127	splice site	probably benign
R8888:Celsr2	UTSW	3	108413564	missense	possibly damaging	0.95
R8895:Celsr2	UTSW	3	108413564	missense	possibly damaging	0.95
R8917:Celsr2	UTSW	3	108396566	missense	probably benign	0.00
R9119:Celsr2	UTSW	3	108401972	missense	possibly damaging	0.90
R9169:Celsr2	UTSW	3	108402546	missense	probably benign	0.04
R9209:Celsr2	UTSW	3	108414033	missense	probably benign	0.02
R9342:Celsr2	UTSW	3	108413126	missense	probably damaging	1.00
R9416:Celsr2	UTSW	3	108414768	missense	probably damaging	0.96
R9493:Celsr2	UTSW	3	108393758	missense	probably damaging	1.00
R9564:Celsr2	UTSW	3	108414518	missense	probably damaging	1.00
R9598:Celsr2	UTSW	3	108415262	missense	possibly damaging	0.72
R9629:Celsr2	UTSW	3	108401599	missense	probably damaging	1.00
R9691:Celsr2	UTSW	3	108394235	missense	probably damaging	1.00
X0020:Celsr2	UTSW	3	108396110	missense	probably damaging	1.00
X0050:Celsr2	UTSW	3	108401272	missense	probably benign	0.09
Z1088:Celsr2	UTSW	3	108414117	missense	probably damaging	1.00
Z1176:Celsr2	UTSW	3	108393131	missense	probably benign	0.10
Z1176:Celsr2	UTSW	3	108412341	missense	probably benign	0.07
Z1177:Celsr2	UTSW	3	108412220	missense	probably damaging	1.00
Z1177:Celsr2	UTSW	3	108413571	missense	probably benign	0.32
Z1191:Celsr2	UTSW	3	108414549	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- TGTTGGCATCGGTGACATTC -3'
(R):5'- GAAGAGGTTGATTTCTACAGCTTTG -3'

Sequencing Primer
(F):5'- GTTGGCATCGGTGACATTCACTAC -3'
(R):5'- ACAGCTTTGGTGTAGAGGCCC -3'

Posted On

2014-12-04