Mutagenetix > Incidental Mutation

Incidental Mutation 'R2504:Sec24d'

252097

Institutional Source

Beutler Lab

Gene Symbol

Sec24d

Ensembl Gene

ENSMUSG00000039234

Gene Name

Sec24 related gene family, member D (S. cerevisiae)

Synonyms

2310020L09Rik, LOC383951

MMRRC Submission

040412-MU

Accession Numbers

Genbank: NM_027135; MGI: 1916858

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2504 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

123267455-123365641 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 123353606 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 708 (I708T)

Ref Sequence

ENSEMBL: ENSMUSP00000035823 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047923]

AlphaFold

Q6NXL1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000047923
AA Change: I708T

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000035823
Gene: ENSMUSG00000039234
AA Change: I708T

Domain	Start	End	E-Value	Type
low complexity region	46	71	N/A	INTRINSIC
low complexity region	75	87	N/A	INTRINSIC
low complexity region	136	160	N/A	INTRINSIC
low complexity region	197	222	N/A	INTRINSIC
low complexity region	238	256	N/A	INTRINSIC
Pfam:zf-Sec23_Sec24	360	398	1.8e-16	PFAM
Pfam:Sec23_trunk	437	681	3.6e-88	PFAM
Pfam:Sec23_BS	686	770	2e-20	PFAM
Pfam:Sec23_helical	783	884	1e-27	PFAM
Pfam:Gelsolin	899	974	4.2e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196631

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197291

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200309

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. This gene product is implicated in the shaping of the vesicle, and also in cargo selection and concentration. Mutations in this gene have been associated with Cole-Carpenter syndrome, a disorder affecting bone formation, resulting in craniofacial malformations and bones that break easily. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. A hypomorphic gene trap allele results in lethality during organogenesis. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock

Total: 113 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	G	A	15: 8,219,216	E1750K	probably damaging	Het
4933425L06Rik	A	G	13: 105,109,742	I270M	probably benign	Het
Aatk	T	C	11: 120,018,855	D28G	probably benign	Het
Abcg1	T	A	17: 31,092,395	S125T	probably damaging	Het
Actbl2	T	C	13: 111,256,183	S351P	possibly damaging	Het
Ankrd34b	A	G	13: 92,439,061		probably null	Het
BC030867	T	C	11: 102,255,296	Y133H	possibly damaging	Het
BC051665	C	T	13: 60,782,654	V295I	probably benign	Het
C1qtnf2	A	G	11: 43,491,156	N265S	probably damaging	Het
Ccdc14	C	T	16: 34,721,850	R573*	probably null	Het
Cd55b	A	T	1: 130,409,875	Y247N	probably damaging	Het
Celsr2	A	T	3: 108,413,591	V635E	probably benign	Het
Clec16a	T	C	16: 10,559,687		probably benign	Het
Clec4b1	A	G	6: 123,065,945	Y41C	probably damaging	Het
Cntn5	A	T	9: 10,172,121	D19E	probably benign	Het
Cop1	A	G	1: 159,232,805	N53S	probably damaging	Het
Csad	A	T	15: 102,188,667	M1K	probably null	Het
Cyb5rl	A	G	4: 107,080,945	I200V	probably benign	Het
Cyp26a1	A	G	19: 37,698,342	T81A	probably damaging	Het
Cyp2d12	A	T	15: 82,559,036	H433L	probably benign	Het
D7Ertd443e	T	A	7: 134,349,479		probably null	Het
Dennd1b	A	G	1: 139,170,170		probably benign	Het
Dmap1	G	T	4: 117,675,298	T357K	probably damaging	Het
Dzip1	G	T	14: 118,881,044	T759K	probably benign	Het
Elmo2	A	G	2: 165,298,687	V300A	probably damaging	Het
Eml5	T	C	12: 98,844,105	D864G	possibly damaging	Het
Ep400	A	G	5: 110,668,645	V2670A	probably damaging	Het
Epha3	T	A	16: 63,603,625	I534F	probably damaging	Het
Epha4	A	C	1: 77,382,991	Y742D	probably damaging	Het
Ergic2	A	G	6: 148,204,774		probably null	Het
Ero1l	A	T	14: 45,299,088		probably null	Het
Fam229a	A	G	4: 129,491,486	D70G	probably damaging	Het
Fbn2	C	T	18: 58,093,359	R781Q	probably damaging	Het
Fbxo16	A	T	14: 65,270,714		probably benign	Het
Fbxo39	T	A	11: 72,317,285	S154R	probably benign	Het
Fer	T	A	17: 63,991,580		probably null	Het
Filip1l	A	G	16: 57,570,662	I538V	possibly damaging	Het
Filip1l	A	T	16: 57,571,047	D428V	probably damaging	Het
Fsip2	T	C	2: 82,979,610	I2091T	possibly damaging	Het
Glyat	A	C	19: 12,651,398	T186P	possibly damaging	Het
Gm10604	A	G	4: 11,980,083	S74P	unknown	Het
Gm4787	T	G	12: 81,379,137	K82N	possibly damaging	Het
Hectd4	T	C	5: 121,220,620	I50T	unknown	Het
Hectd4	T	C	5: 121,263,967	S373P	possibly damaging	Het
Hmcn1	A	T	1: 150,686,867	C2313*	probably null	Het
Igfn1	A	T	1: 135,969,316	S1171T	probably benign	Het
Ints8	T	C	4: 11,241,642	D267G	probably benign	Het
Itln1	A	G	1: 171,529,159	C251R	probably damaging	Het
Jcad	C	T	18: 4,674,026	T596M	probably damaging	Het
Kcnj16	C	T	11: 111,025,583	T357M	probably benign	Het
Kif13a	G	A	13: 46,814,200	T346M	probably damaging	Het
Klhl24	G	A	16: 20,120,167	A491T	probably benign	Het
Kntc1	C	T	5: 123,778,347	Q748*	probably null	Het
Krt25	T	A	11: 99,317,296	K369*	probably null	Het
Krt75	C	T	15: 101,568,031	R433Q	probably benign	Het
Krt76	A	G	15: 101,884,858	F582L	unknown	Het
Lysmd1	G	A	3: 95,138,397	V182I	probably benign	Het
Mab21l2	T	A	3: 86,547,555	E46V	probably damaging	Het
Magi2	A	T	5: 20,358,936	K355N	probably damaging	Het
March10	T	C	11: 105,385,572	D630G	probably damaging	Het
Mast4	A	T	13: 102,738,639	I1215N	probably damaging	Het
Nckap1	G	A	2: 80,530,218	T523I	probably benign	Het
Nexmif	T	A	X: 104,084,393	D1306V	probably damaging	Het
Nfkb1	A	C	3: 135,589,329	I918R	possibly damaging	Het
Nup50	A	T	15: 84,933,658	T93S	probably benign	Het
Nwd2	T	C	5: 63,804,374	Y434H	probably benign	Het
Olfr61	T	C	7: 140,638,484	V261A	probably benign	Het
Osbpl1a	C	A	18: 12,905,031	V288L	probably benign	Het
Pan3	A	G	5: 147,527,036	E562G	possibly damaging	Het
Pappa	T	A	4: 65,180,889	Y548*	probably null	Het
Phf3	A	T	1: 30,810,789	L1181Q	probably damaging	Het
Phip	T	C	9: 82,915,339	H537R	possibly damaging	Het
Pkhd1l1	T	C	15: 44,485,428	I240T	probably damaging	Het
Pole	G	A	5: 110,290,502		probably null	Het
Polq	T	A	16: 37,011,942	S15T	unknown	Het
Prrt2	T	C	7: 127,020,224	E23G	possibly damaging	Het
Prss37	A	T	6: 40,517,826		probably null	Het
Prune2	T	C	19: 17,000,036	L45P	probably damaging	Het
Psd	A	T	19: 46,324,913	M6K	possibly damaging	Het
Psmd1	A	G	1: 86,089,997	E510G	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Pxdn	T	A	12: 30,003,406	I1194N	probably damaging	Het
Rbp3	C	T	14: 33,956,018	T641M	probably damaging	Het
Rgmb	C	A	17: 15,807,647	R270L	probably benign	Het
Rpgrip1l	A	G	8: 91,280,716		probably null	Het
Rps2	G	A	17: 24,720,379		probably benign	Het
Rsbn1l	G	T	5: 20,902,366	A550E	probably damaging	Het
S1pr4	C	T	10: 81,499,304	R112H	probably benign	Het
Scfd2	T	C	5: 74,531,177	N148S	probably damaging	Het
Scin	C	T	12: 40,081,706	M276I	probably benign	Het
Skint11	T	A	4: 114,228,812	F41I	possibly damaging	Het
Slc15a4	A	T	5: 127,617,239	F44Y	possibly damaging	Het
Slc6a18	A	G	13: 73,675,806	Y72H	probably benign	Het
Slc7a11	A	T	3: 50,377,746		probably null	Het
Slc7a14	G	T	3: 31,237,501	N209K	possibly damaging	Het
Sstr2	T	C	11: 113,624,431	C59R	probably damaging	Het
Stab1	A	G	14: 31,163,040		probably null	Het
Stag1	G	T	9: 100,866,210	S475I	probably damaging	Het
Stxbp5l	A	G	16: 37,115,667	Y1183H	probably damaging	Het
Svep1	A	T	4: 58,135,628		probably null	Het
Tm9sf2	A	G	14: 122,158,684	T653A	probably benign	Het
Tmeff1	T	C	4: 48,662,059	S366P	possibly damaging	Het
Tnnt2	G	T	1: 135,852,065	W300L	probably damaging	Het
Traj32	A	G	14: 54,186,103		probably benign	Het
Trp53bp2	A	T	1: 182,441,639	M223L	probably benign	Het
Tsga10	G	A	1: 37,815,677	T246M	probably damaging	Het
Txn2	A	T	15: 77,926,670		probably benign	Het
Ubr3	T	A	2: 69,938,198	F450I	probably damaging	Het
Usp47	T	C	7: 112,104,470		probably null	Het
Vars2	C	T	17: 35,664,793	R244Q	probably damaging	Het
Xrra1	T	A	7: 99,897,596	F251L	probably damaging	Het
Zfp804a	G	A	2: 82,257,519	R564Q	probably benign	Het
Zfp983	T	C	17: 21,658,967	C29R	probably damaging	Het

Other mutations in Sec24d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01420:Sec24d	APN	3	123350009	missense	probably benign	0.00
IGL01621:Sec24d	APN	3	123294158	critical splice acceptor site	probably null
IGL01866:Sec24d	APN	3	123293595	nonsense	probably null
IGL02064:Sec24d	APN	3	123343814	splice site	probably benign
IGL02125:Sec24d	APN	3	123358958	missense	probably damaging	1.00
IGL02173:Sec24d	APN	3	123353681	missense	probably damaging	1.00
IGL03239:Sec24d	APN	3	123336489	missense	probably benign	0.00
Scanty	UTSW	3	123354947	missense	probably damaging	1.00
3-1:Sec24d	UTSW	3	123353630	missense	possibly damaging	0.94
PIT4531001:Sec24d	UTSW	3	123343178	missense	probably damaging	1.00
R0008:Sec24d	UTSW	3	123350876	splice site	probably benign
R0838:Sec24d	UTSW	3	123305836	missense	probably benign	0.08
R1775:Sec24d	UTSW	3	123336517	missense	probably damaging	1.00
R1895:Sec24d	UTSW	3	123353394	missense	probably benign	0.04
R1946:Sec24d	UTSW	3	123353394	missense	probably benign	0.04
R2238:Sec24d	UTSW	3	123349894	splice site	probably null
R2846:Sec24d	UTSW	3	123350746	missense	probably damaging	0.98
R2895:Sec24d	UTSW	3	123343151	missense	probably damaging	1.00
R3428:Sec24d	UTSW	3	123343923	splice site	probably benign
R4573:Sec24d	UTSW	3	123358870	missense	probably damaging	1.00
R4668:Sec24d	UTSW	3	123355774	missense	probably damaging	0.98
R4706:Sec24d	UTSW	3	123355778	missense	possibly damaging	0.80
R4896:Sec24d	UTSW	3	123354947	missense	probably damaging	1.00
R4982:Sec24d	UTSW	3	123299606	missense	probably benign	0.29
R5030:Sec24d	UTSW	3	123358901	missense	probably damaging	0.98
R5041:Sec24d	UTSW	3	123294231	missense	probably damaging	0.96
R5078:Sec24d	UTSW	3	123290552	missense	probably benign	0.00
R5108:Sec24d	UTSW	3	123305785	splice site	probably null
R5174:Sec24d	UTSW	3	123364926	missense	probably damaging	0.99
R5661:Sec24d	UTSW	3	123343085	missense	probably damaging	1.00
R5661:Sec24d	UTSW	3	123343142	missense	possibly damaging	0.95
R5775:Sec24d	UTSW	3	123290460	missense	probably benign	0.00
R5859:Sec24d	UTSW	3	123279312	unclassified	probably benign
R5944:Sec24d	UTSW	3	123293581	missense	probably benign	0.01
R6053:Sec24d	UTSW	3	123279222	nonsense	probably null
R6515:Sec24d	UTSW	3	123343070	missense	possibly damaging	0.92
R6552:Sec24d	UTSW	3	123290552	missense	probably benign	0.00
R6557:Sec24d	UTSW	3	123343087	missense	probably damaging	1.00
R6593:Sec24d	UTSW	3	123353412	missense	probably damaging	1.00
R6594:Sec24d	UTSW	3	123293763	missense	probably damaging	1.00
R6842:Sec24d	UTSW	3	123343219	missense	probably benign	0.00
R7072:Sec24d	UTSW	3	123330351	missense	probably damaging	1.00
R7481:Sec24d	UTSW	3	123350763	missense	probably damaging	1.00
R7554:Sec24d	UTSW	3	123355774	missense	probably damaging	1.00
R8270:Sec24d	UTSW	3	123305886	missense	possibly damaging	0.90
R8481:Sec24d	UTSW	3	123353424	missense	probably damaging	1.00
R8713:Sec24d	UTSW	3	123343892	missense	probably damaging	1.00
R8872:Sec24d	UTSW	3	123354936	splice site	probably benign
R8922:Sec24d	UTSW	3	123350839	missense	probably damaging	1.00
R8974:Sec24d	UTSW	3	123305849	missense	probably damaging	1.00
R9015:Sec24d	UTSW	3	123327638	missense	probably benign	0.43
R9050:Sec24d	UTSW	3	123350725	missense	probably benign	0.00
R9065:Sec24d	UTSW	3	123355803	missense	probably damaging	1.00
R9128:Sec24d	UTSW	3	123294161	missense	probably benign
R9447:Sec24d	UTSW	3	123290513	missense	probably benign	0.00
R9701:Sec24d	UTSW	3	123269672	missense	probably damaging	1.00
R9758:Sec24d	UTSW	3	123343154	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACATTCAGATAGCCAAAGGTTTCTG -3'
(R):5'- ACTCTAAGGACTCCTGCTTGG -3'

Sequencing Primer
(F):5'- CGACCTCCGGAATGATATTGAG -3'
(R):5'- CCTGCTTGGGAGAAAGAGTTC -3'

Posted On

2014-12-04