Mutagenetix > Incidental Mutation

Incidental Mutation 'R2850:Ahi1'

252108

Institutional Source

Beutler Lab

Gene Symbol

Ahi1

Ensembl Gene

ENSMUSG00000019986

Gene Name

Abelson helper integration site 1

Synonyms

1700015F03Rik, Jouberin, D10Bwg0629e, Ahi-1

MMRRC Submission

040443-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.874) question?

Stock #

R2850 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20952547-21080429 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 21000593 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 801 (T801I)

Ref Sequence

ENSEMBL: ENSMUSP00000101164 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105525] [ENSMUST00000213104]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000105525
AA Change: T801I

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000101164
Gene: ENSMUSG00000019986
AA Change: T801I

Domain	Start	End	E-Value	Type
low complexity region	50	67	N/A	INTRINSIC
low complexity region	85	106	N/A	INTRINSIC
low complexity region	148	159	N/A	INTRINSIC
WD40	448	490	4.3e-1	SMART
WD40	493	532	9.3e-9	SMART
WD40	537	576	2.48e-4	SMART
WD40	583	622	6.09e-4	SMART
WD40	641	678	1.9e2	SMART
WD40	684	721	3.98e0	SMART
WD40	724	769	9.51e1	SMART
SH3	905	961	2.15e-21	SMART
low complexity region	975	989	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000213104
AA Change: T801I

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214893

Meta Mutation Damage Score

0.2594

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.7%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is apparently required for both cerebellar and cortical development in humans. This gene mutations cause specific forms of Joubert syndrome-related disorders. Joubert syndrome (JS) is a recessively inherited developmental brain disorder with several identified causative chromosomal loci. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mouse embryonic fibroblasts homozygous for one knock-out allele exhibit reduced and abnormal cilia. Mice homozygous for another knock-out allele exhibit premature death and abnormal kidney morphology and physiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actn2	T	A	13: 12,275,179	T734S	probably damaging	Het
Ago1	T	C	4: 126,443,075		probably benign	Het
Alms1	T	C	6: 85,621,299	S1505P	probably benign	Het
Alms1	C	A	6: 85,667,963		probably benign	Het
Anxa6	T	A	11: 55,011,026	Y95F	possibly damaging	Het
Cacna1b	C	T	2: 24,761,788	M126I	probably damaging	Het
Clk1	A	G	1: 58,412,279	L457S	probably damaging	Het
Cngb3	T	C	4: 19,415,690	I400T	possibly damaging	Het
Cntnap5c	T	A	17: 58,410,348		probably benign	Het
Corin	A	G	5: 72,304,955	V837A	probably damaging	Het
Ctr9	C	T	7: 111,053,446	R984C	unknown	Het
Cubn	G	A	2: 13,322,953	T2687I	probably damaging	Het
Cypt3	T	A	X: 153,559,278	N168K	probably damaging	Het
E330020D12Rik	A	G	1: 153,406,590		noncoding transcript	Het
Fbxl4	T	C	4: 22,403,624	M399T	probably benign	Het
Fbxo22	T	C	9: 55,223,415	F323L	probably damaging	Het
Fnip1	A	T	11: 54,502,677	E646D	probably benign	Het
Gid4	G	A	11: 60,438,574		probably null	Het
Gnb5	A	T	9: 75,327,229	D70V	probably damaging	Het
Gpank1	A	G	17: 35,124,581	S346G	probably benign	Het
Gtf3c6	T	C	10: 40,254,258		probably benign	Het
Hdx	T	C	X: 111,593,023	I562V	probably benign	Het
Ifrd2	T	C	9: 107,591,709		probably benign	Het
Itch	A	C	2: 155,202,221	Q482P	probably benign	Het
Kif11	C	A	19: 37,409,493	D630E	probably benign	Het
Lpl	G	T	8: 68,899,512	E372*	probably null	Het
Mrps26	T	C	2: 130,565,047	V198A	probably benign	Het
Mucl1	T	C	15: 103,752,082	N201S	possibly damaging	Het
Nedd4	C	T	9: 72,725,074	L397F	possibly damaging	Het
Nfat5	A	G	8: 107,293,860	D12G	probably damaging	Het
Olfr1454	T	C	19: 13,063,570	L53P	probably damaging	Het
Pik3r3	A	G	4: 116,270,784		probably benign	Het
Pkd1l3	T	A	8: 109,623,990	V489E	possibly damaging	Het
Pkhd1	T	C	1: 20,509,076	E1802G	possibly damaging	Het
Plb1	T	A	5: 32,293,224	S370T	probably benign	Het
Ppat	G	A	5: 76,919,375	T337I	probably benign	Het
Prkd3	A	G	17: 78,954,596	V763A	possibly damaging	Het
Prr9	A	T	3: 92,123,169	S55T	probably benign	Het
Rbpms	G	T	8: 33,834,377	N108K	possibly damaging	Het
Rc3h2	A	T	2: 37,377,415	D972E	probably benign	Het
Rrbp1	C	T	2: 143,949,349	R1378Q	probably benign	Het
Slc26a7	T	A	4: 14,593,806		probably benign	Het
Stard6	T	A	18: 70,483,451	H60Q	probably benign	Het
Sult6b2	T	C	6: 142,797,887	T138A	probably benign	Het
Th	G	A	7: 142,894,075	Q329*	probably null	Het
Tmco3	A	G	8: 13,295,024	H268R	probably benign	Het
Tnn	T	C	1: 160,139,287	D429G	probably benign	Het
Tnrc6a	G	A	7: 123,179,800	G1245R	probably damaging	Het
Trem3	C	A	17: 48,249,641	L47M	probably benign	Het
Trpm6	T	A	19: 18,792,090	C307S	possibly damaging	Het
Ube2j1	T	A	4: 33,049,696	N231K	probably benign	Het
Urb1	A	G	16: 90,774,256	Y1222H	probably benign	Het
Wdr81	A	T	11: 75,451,172	S1090T	probably damaging	Het
Ythdf3	T	C	3: 16,203,818		probably benign	Het
Zfp280d	A	G	9: 72,312,089	T183A	probably benign	Het
Zfp354c	G	A	11: 50,815,331	Q306*	probably null	Het
Zp2	T	C	7: 120,138,306	H252R	probably benign	Het

Other mutations in Ahi1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00754:Ahi1	APN	10	20972141	missense	probably damaging	1.00
IGL00914:Ahi1	APN	10	20984299	splice site	probably null
IGL01075:Ahi1	APN	10	20987025	missense	possibly damaging	0.80
IGL01094:Ahi1	APN	10	20972060	missense	probably damaging	0.99
IGL01128:Ahi1	APN	10	21074433	missense	probably benign
IGL01527:Ahi1	APN	10	20960085	splice site	probably benign
IGL01821:Ahi1	APN	10	21041243	critical splice donor site	probably null
IGL02159:Ahi1	APN	10	21058177	missense	probably benign	0.13
IGL02176:Ahi1	APN	10	20970916	missense	probably benign	0.00
IGL02200:Ahi1	APN	10	20981314	splice site	probably benign
IGL02232:Ahi1	APN	10	20981375	missense	probably damaging	1.00
IGL02305:Ahi1	APN	10	20970897	missense	probably benign	0.00
IGL02323:Ahi1	APN	10	20972034	missense	probably damaging	1.00
IGL02885:Ahi1	APN	10	21055113	missense	possibly damaging	0.61
IGL02958:Ahi1	APN	10	20963799	missense	probably damaging	1.00
IGL02971:Ahi1	APN	10	21000551	missense	possibly damaging	0.93
IGL03109:Ahi1	APN	10	20970942	missense	probably benign	0.00
IGL03192:Ahi1	APN	10	20965635	missense	probably benign	0.00
IGL03377:Ahi1	APN	10	21018004	missense	possibly damaging	0.51
arisen	UTSW	10	21007768	missense	possibly damaging	0.53
urspringt	UTSW	10	20984393	missense	probably damaging	1.00
P4717OSA:Ahi1	UTSW	10	20972110	missense	probably damaging	1.00
P4748:Ahi1	UTSW	10	20972110	missense	probably damaging	1.00
R0448:Ahi1	UTSW	10	20972075	missense	probably damaging	1.00
R0559:Ahi1	UTSW	10	21000719	splice site	probably benign
R0627:Ahi1	UTSW	10	20965522	missense	probably benign	0.10
R0652:Ahi1	UTSW	10	20979461	missense	probably damaging	1.00
R0690:Ahi1	UTSW	10	20970843	splice site	probably benign
R1209:Ahi1	UTSW	10	20963730	missense	probably damaging	0.98
R1364:Ahi1	UTSW	10	20972156	missense	probably damaging	0.97
R1510:Ahi1	UTSW	10	20959800	missense	probably benign	0.00
R1634:Ahi1	UTSW	10	20965693	missense	probably damaging	1.00
R1789:Ahi1	UTSW	10	20963115	missense	probably benign	0.18
R1818:Ahi1	UTSW	10	20988562	missense	probably damaging	1.00
R2069:Ahi1	UTSW	10	20959996	missense	probably damaging	0.98
R2148:Ahi1	UTSW	10	20970976	missense	possibly damaging	0.64
R2566:Ahi1	UTSW	10	20970911	nonsense	probably null
R2862:Ahi1	UTSW	10	20981408	missense	probably damaging	0.99
R3969:Ahi1	UTSW	10	20959947	missense	probably damaging	1.00
R4430:Ahi1	UTSW	10	20972078	missense	probably damaging	1.00
R4496:Ahi1	UTSW	10	20965545	missense	probably benign	0.07
R4755:Ahi1	UTSW	10	21055047	missense	possibly damaging	0.94
R4916:Ahi1	UTSW	10	20984404	missense	probably damaging	1.00
R5216:Ahi1	UTSW	10	20960076	missense	probably benign	0.00
R5223:Ahi1	UTSW	10	20970919	missense	possibly damaging	0.79
R5224:Ahi1	UTSW	10	20987022	missense	probably damaging	1.00
R5604:Ahi1	UTSW	10	20987005	missense	probably damaging	1.00
R5665:Ahi1	UTSW	10	21055047	missense	possibly damaging	0.94
R5704:Ahi1	UTSW	10	21074427	missense	probably benign
R5769:Ahi1	UTSW	10	20960082	critical splice donor site	probably null
R5899:Ahi1	UTSW	10	21000566	missense	probably benign	0.06
R5936:Ahi1	UTSW	10	20965933	missense	probably damaging	1.00
R5969:Ahi1	UTSW	10	20984393	missense	probably damaging	1.00
R6066:Ahi1	UTSW	10	20959926	missense	possibly damaging	0.84
R6122:Ahi1	UTSW	10	21058165	missense	probably benign	0.26
R6135:Ahi1	UTSW	10	20969121	missense	probably benign	0.01
R6240:Ahi1	UTSW	10	20977081	missense	probably damaging	1.00
R6387:Ahi1	UTSW	10	20969043	missense	probably damaging	1.00
R6395:Ahi1	UTSW	10	20979592	missense	possibly damaging	0.49
R6406:Ahi1	UTSW	10	20977049	missense	probably damaging	1.00
R6440:Ahi1	UTSW	10	20960082	critical splice donor site	probably benign
R6558:Ahi1	UTSW	10	20963673	missense	probably damaging	1.00
R6744:Ahi1	UTSW	10	20965567	missense	probably damaging	1.00
R6755:Ahi1	UTSW	10	21017913	missense	probably damaging	0.98
R6927:Ahi1	UTSW	10	21055069	missense	probably damaging	1.00
R6932:Ahi1	UTSW	10	20963691	missense	probably benign	0.02
R6967:Ahi1	UTSW	10	20988625	missense	probably damaging	0.98
R7168:Ahi1	UTSW	10	21017932	missense	probably benign	0.01
R7169:Ahi1	UTSW	10	21055019	missense	probably damaging	1.00
R7327:Ahi1	UTSW	10	20987077	missense	probably damaging	0.99
R7351:Ahi1	UTSW	10	20965933	missense	probably damaging	1.00
R7489:Ahi1	UTSW	10	20963750	missense	probably benign	0.35
R7680:Ahi1	UTSW	10	21007768	missense	possibly damaging	0.53
R7878:Ahi1	UTSW	10	20981431	critical splice donor site	probably null
R7999:Ahi1	UTSW	10	20965681	missense	probably benign	0.31
R8219:Ahi1	UTSW	10	21074436	missense	probably benign	0.00
R8248:Ahi1	UTSW	10	20972092	missense	probably benign	0.04
R8560:Ahi1	UTSW	10	20959915	missense	probably benign	0.04
R8926:Ahi1	UTSW	10	21055083	missense	probably damaging	1.00
R8965:Ahi1	UTSW	10	20963862	missense	probably benign
R8987:Ahi1	UTSW	10	20963784	missense	probably damaging	1.00
R9013:Ahi1	UTSW	10	21007759	missense	probably benign	0.28
R9145:Ahi1	UTSW	10	21000589	missense	probably benign	0.01
R9365:Ahi1	UTSW	10	20972136	missense	probably damaging	0.99
R9567:Ahi1	UTSW	10	20981401	missense	possibly damaging	0.95
X0024:Ahi1	UTSW	10	21000592	missense	possibly damaging	0.69
Z1177:Ahi1	UTSW	10	21041007	intron	probably benign

Predicted Primers

PCR Primer
(F):5'- TTGCATTGCCTTCAAAGCTC -3'
(R):5'- GGCTTCAAAACTAGTGCTTGAAAAG -3'

Sequencing Primer
(F):5'- CTTACCAGTTATGTTGCCTATCAATG -3'
(R):5'- GACAGTTTCGAGTCTCTG -3'

Posted On

2014-12-04