Incidental Mutation 'R0311:Pbld2'
ID25212
Institutional Source Beutler Lab
Gene Symbol Pbld2
Ensembl Gene ENSMUSG00000020072
Gene Namephenazine biosynthesis-like protein domain containing 2
Synonyms3110049J23Rik
MMRRC Submission 038521-MU
Accession Numbers

Genbank: NM_026085 ; MGI: 1914557

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0311 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location63024315-63058813 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 63054507 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020262] [ENSMUST00000124784]
Predicted Effect probably null
Transcript: ENSMUST00000020262
SMART Domains Protein: ENSMUSP00000020262
Gene: ENSMUSG00000020072

DomainStartEndE-ValueType
Pfam:PhzC-PhzF 8 284 2e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124784
SMART Domains Protein: ENSMUSP00000121682
Gene: ENSMUSG00000020072

DomainStartEndE-ValueType
Pfam:PhzC-PhzF 69 175 1.5e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155982
Meta Mutation Damage Score 0.9487 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.6%
  • 20x: 91.6%
Validation Efficiency 100% (43/43)
Allele List at MGI

All alleles(21) : Gene trapped(21)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A C 7: 120,402,904 M1547L probably damaging Het
Abcb4 A G 5: 8,934,243 K658E probably benign Het
Abr A G 11: 76,509,127 S15P possibly damaging Het
Adgrb2 G C 4: 130,017,129 A1168P probably damaging Het
Adgre4 A T 17: 55,802,010 E339V probably benign Het
Asprv1 T C 6: 86,628,840 W223R probably damaging Het
Ccdc89 A G 7: 90,426,693 E37G probably damaging Het
Cd48 C A 1: 171,699,580 Y191* probably null Het
Chd4 T C 6: 125,101,665 I257T probably benign Het
Clca4b T C 3: 144,932,496 M2V probably benign Het
Dnah11 A T 12: 118,127,133 D1025E probably benign Het
Erich5 A G 15: 34,472,939 *363W probably null Het
Etl4 A G 2: 20,807,129 D1341G probably damaging Het
Fbxw11 A G 11: 32,722,083 T184A probably benign Het
Fktn A G 4: 53,744,620 Q300R probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gdpd3 G A 7: 126,767,189 R66Q possibly damaging Het
Hexb A G 13: 97,183,819 probably benign Het
Kdm4b A G 17: 56,386,200 R346G probably benign Het
Mbtd1 T A 11: 93,921,357 probably null Het
Med23 T A 10: 24,897,358 C653S possibly damaging Het
Nwd2 A T 5: 63,804,998 I642L probably damaging Het
Olfr1444 A G 19: 12,861,869 I31M probably benign Het
Olfr1448 T A 19: 12,920,096 Y71F possibly damaging Het
Olfr912 T C 9: 38,539,297 V134A probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Plpp2 C T 10: 79,527,580 R77K probably damaging Het
Pym1 G T 10: 128,765,984 R168L possibly damaging Het
Rbm4 T C 19: 4,787,556 Y300C probably damaging Het
Rnf207 A G 4: 152,315,779 C175R probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Speg T C 1: 75,430,937 V3196A probably damaging Het
Syne1 T A 10: 5,348,943 I1048L possibly damaging Het
Th T C 7: 142,896,041 E41G probably damaging Het
Tmx4 T A 2: 134,598,526 *336L probably null Het
Tnfrsf18 T C 4: 156,026,415 V10A possibly damaging Het
Tnxb A T 17: 34,716,984 I2670F probably damaging Het
Tpx2 T C 2: 152,890,492 V562A probably damaging Het
Vmn2r73 A G 7: 85,871,789 S324P probably benign Het
Vps18 T C 2: 119,297,365 Y890H probably benign Het
Ythdc1 G A 5: 86,835,705 D670N probably damaging Het
Other mutations in Pbld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Pbld2 APN 10 63071955 missense probably benign 0.01
IGL02162:Pbld2 APN 10 63071400 splice site probably benign
IGL03206:Pbld2 APN 10 63047482 missense probably benign 0.06
R0366:Pbld2 UTSW 10 63053957 unclassified probably benign
R0727:Pbld2 UTSW 10 63067519 missense probably benign 0.03
R0731:Pbld2 UTSW 10 63056811 missense probably damaging 1.00
R1412:Pbld2 UTSW 10 63047522 missense probably damaging 1.00
R1523:Pbld2 UTSW 10 63076433 missense probably benign 0.01
R1531:Pbld2 UTSW 10 63053953 critical splice donor site probably null
R1773:Pbld2 UTSW 10 63054371 missense probably benign 0.03
R1778:Pbld2 UTSW 10 63054371 missense probably benign 0.03
R1797:Pbld2 UTSW 10 63075124 critical splice donor site probably null
R2251:Pbld2 UTSW 10 63024605 unclassified probably benign
R3036:Pbld2 UTSW 10 63071446 missense probably damaging 1.00
R3117:Pbld2 UTSW 10 63054436 missense probably benign 0.00
R3622:Pbld2 UTSW 10 63061691 missense probably damaging 0.97
R3624:Pbld2 UTSW 10 63061691 missense probably damaging 0.97
R3734:Pbld2 UTSW 10 63071465 missense probably damaging 1.00
R4260:Pbld2 UTSW 10 63024407 unclassified probably benign
R4684:Pbld2 UTSW 10 63057697 missense probably damaging 1.00
R4928:Pbld2 UTSW 10 63047999 missense probably damaging 1.00
R4936:Pbld2 UTSW 10 63052238 missense probably damaging 1.00
R5508:Pbld2 UTSW 10 63066665 unclassified probably null
R5596:Pbld2 UTSW 10 63072012 missense probably damaging 1.00
R5603:Pbld2 UTSW 10 63071449 missense probably benign
R6298:Pbld2 UTSW 10 63039152 missense probably benign 0.05
R6404:Pbld2 UTSW 10 63054328 missense probably damaging 0.98
R7089:Pbld2 UTSW 10 63053912 missense probably benign 0.23
R7134:Pbld2 UTSW 10 63024589 unclassified probably benign
R7423:Pbld2 UTSW 10 63048004 missense probably damaging 1.00
R8016:Pbld2 UTSW 10 63047965 missense probably damaging 1.00
R8039:Pbld2 UTSW 10 63047992 missense probably damaging 1.00
YA93:Pbld2 UTSW 10 63054445 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGTCTCCAAAGCATGGCTTCCC -3'
(R):5'- GCTCACTATCTTGACAGTGTGCCC -3'

Sequencing Primer
(F):5'- atccacctgcctctgcc -3'
(R):5'- GACAGTGTGCCCTCTTCTG -3'
Posted On2013-04-16