Mutagenetix > Incidental Mutations

Incidental Mutation 'R2850:Urb1'

252132

Institutional Source

Beutler Lab

Gene Symbol

Urb1

Ensembl Gene

ENSMUSG00000039929

Gene Name

URB1 ribosome biogenesis 1 homolog (S. cerevisiae)

Synonyms

4921511H13Rik, 5730405K23Rik

MMRRC Submission

040443-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2850 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

90751527-90810413 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 90774256 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 1222 (Y1222H)

Ref Sequence

ENSEMBL: ENSMUSP00000114717 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000140920]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140158

Predicted Effect

probably benign
Transcript: ENSMUST00000140920
AA Change: Y1222H

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000114717
Gene: ENSMUSG00000039929
AA Change: Y1222H

Domain	Start	End	E-Value	Type
low complexity region	8	20	N/A	INTRINSIC
Pfam:Npa1	78	396	1.5e-86	PFAM
low complexity region	751	761	N/A	INTRINSIC
low complexity region	955	966	N/A	INTRINSIC
low complexity region	1126	1137	N/A	INTRINSIC
low complexity region	1360	1375	N/A	INTRINSIC
Pfam:NopRA1	1670	1859	3.6e-60	PFAM
low complexity region	2029	2040	N/A	INTRINSIC
low complexity region	2092	2111	N/A	INTRINSIC

Meta Mutation Damage Score

0.0602

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.7%

Validation Efficiency

100% (57/57)

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actn2	T	A	13: 12,275,179	T734S	probably damaging	Het
Ago1	T	C	4: 126,443,075		probably benign	Het
Ahi1	C	T	10: 21,000,593	T801I	probably benign	Het
Alms1	T	C	6: 85,621,299	S1505P	probably benign	Het
Alms1	C	A	6: 85,667,963		probably benign	Het
Anxa6	T	A	11: 55,011,026	Y95F	possibly damaging	Het
Cacna1b	C	T	2: 24,761,788	M126I	probably damaging	Het
Clk1	A	G	1: 58,412,279	L457S	probably damaging	Het
Cngb3	T	C	4: 19,415,690	I400T	possibly damaging	Het
Cntnap5c	T	A	17: 58,410,348		probably benign	Het
Corin	A	G	5: 72,304,955	V837A	probably damaging	Het
Ctr9	C	T	7: 111,053,446	R984C	unknown	Het
Cubn	G	A	2: 13,322,953	T2687I	probably damaging	Het
Cypt3	T	A	X: 153,559,278	N168K	probably damaging	Het
E330020D12Rik	A	G	1: 153,406,590		noncoding transcript	Het
Fbxl4	T	C	4: 22,403,624	M399T	probably benign	Het
Fbxo22	T	C	9: 55,223,415	F323L	probably damaging	Het
Fnip1	A	T	11: 54,502,677	E646D	probably benign	Het
Gid4	G	A	11: 60,438,574		probably null	Het
Gnb5	A	T	9: 75,327,229	D70V	probably damaging	Het
Gpank1	A	G	17: 35,124,581	S346G	probably benign	Het
Gtf3c6	T	C	10: 40,254,258		probably benign	Het
Hdx	T	C	X: 111,593,023	I562V	probably benign	Het
Ifrd2	T	C	9: 107,591,709		probably benign	Het
Itch	A	C	2: 155,202,221	Q482P	probably benign	Het
Kif11	C	A	19: 37,409,493	D630E	probably benign	Het
Lpl	G	T	8: 68,899,512	E372*	probably null	Het
Mrps26	T	C	2: 130,565,047	V198A	probably benign	Het
Mucl1	T	C	15: 103,752,082	N201S	possibly damaging	Het
Nedd4	C	T	9: 72,725,074	L397F	possibly damaging	Het
Nfat5	A	G	8: 107,293,860	D12G	probably damaging	Het
Olfr1454	T	C	19: 13,063,570	L53P	probably damaging	Het
Pik3r3	A	G	4: 116,270,784		probably benign	Het
Pkd1l3	T	A	8: 109,623,990	V489E	possibly damaging	Het
Pkhd1	T	C	1: 20,509,076	E1802G	possibly damaging	Het
Plb1	T	A	5: 32,293,224	S370T	probably benign	Het
Ppat	G	A	5: 76,919,375	T337I	probably benign	Het
Prkd3	A	G	17: 78,954,596	V763A	possibly damaging	Het
Prr9	A	T	3: 92,123,169	S55T	probably benign	Het
Rbpms	G	T	8: 33,834,377	N108K	possibly damaging	Het
Rc3h2	A	T	2: 37,377,415	D972E	probably benign	Het
Rrbp1	C	T	2: 143,949,349	R1378Q	probably benign	Het
Slc26a7	T	A	4: 14,593,806		probably benign	Het
Stard6	T	A	18: 70,483,451	H60Q	probably benign	Het
Sult6b2	T	C	6: 142,797,887	T138A	probably benign	Het
Th	G	A	7: 142,894,075	Q329*	probably null	Het
Tmco3	A	G	8: 13,295,024	H268R	probably benign	Het
Tnn	T	C	1: 160,139,287	D429G	probably benign	Het
Tnrc6a	G	A	7: 123,179,800	G1245R	probably damaging	Het
Trem3	C	A	17: 48,249,641	L47M	probably benign	Het
Trpm6	T	A	19: 18,792,090	C307S	possibly damaging	Het
Ube2j1	T	A	4: 33,049,696	N231K	probably benign	Het
Wdr81	A	T	11: 75,451,172	S1090T	probably damaging	Het
Ythdf3	T	C	3: 16,203,818		probably benign	Het
Zfp280d	A	G	9: 72,312,089	T183A	probably benign	Het
Zfp354c	G	A	11: 50,815,331	Q306*	probably null	Het
Zp2	T	C	7: 120,138,306	H252R	probably benign	Het

Other mutations in Urb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00715:Urb1	APN	16	90753321	critical splice donor site	probably null
IGL00915:Urb1	APN	16	90779098	missense	possibly damaging	0.76
IGL01108:Urb1	APN	16	90792814	missense	probably damaging	1.00
IGL01122:Urb1	APN	16	90804458	missense	possibly damaging	0.81
IGL01387:Urb1	APN	16	90757761	missense	possibly damaging	0.64
IGL01484:Urb1	APN	16	90777560	missense	probably benign	0.11
IGL01606:Urb1	APN	16	90760459	missense	probably damaging	1.00
IGL01989:Urb1	APN	16	90769586	splice site	probably benign
IGL02516:Urb1	APN	16	90772695	missense	possibly damaging	0.49
IGL03018:Urb1	APN	16	90788156	missense	probably benign	0.02
IGL03165:Urb1	APN	16	90780304	missense	probably damaging	1.00
IGL03216:Urb1	APN	16	90788114	missense	probably benign	0.00
H8562:Urb1	UTSW	16	90769469	missense	probably benign	0.08
H8786:Urb1	UTSW	16	90769469	missense	probably benign	0.08
R0064:Urb1	UTSW	16	90779140	missense	probably benign
R0064:Urb1	UTSW	16	90779140	missense	probably benign
R0359:Urb1	UTSW	16	90791160	missense	probably damaging	1.00
R0386:Urb1	UTSW	16	90796399	missense	probably damaging	1.00
R0508:Urb1	UTSW	16	90783262	splice site	probably benign
R0517:Urb1	UTSW	16	90777422	nonsense	probably null
R0704:Urb1	UTSW	16	90776207	missense	probably benign	0.31
R0755:Urb1	UTSW	16	90774094	missense	probably damaging	1.00
R0755:Urb1	UTSW	16	90779138	missense	probably benign
R0783:Urb1	UTSW	16	90810297	missense	possibly damaging	0.55
R0833:Urb1	UTSW	16	90795448	missense	possibly damaging	0.89
R0836:Urb1	UTSW	16	90795448	missense	possibly damaging	0.89
R0970:Urb1	UTSW	16	90769447	missense	possibly damaging	0.83
R1144:Urb1	UTSW	16	90776318	splice site	probably null
R1344:Urb1	UTSW	16	90769466	missense	probably damaging	1.00
R1418:Urb1	UTSW	16	90769466	missense	probably damaging	1.00
R1453:Urb1	UTSW	16	90796492	missense	probably damaging	1.00
R1470:Urb1	UTSW	16	90752014	missense	probably benign	0.34
R1470:Urb1	UTSW	16	90752014	missense	probably benign	0.34
R1520:Urb1	UTSW	16	90774745	missense	probably benign	0.00
R1521:Urb1	UTSW	16	90753863	missense	probably damaging	1.00
R1598:Urb1	UTSW	16	90777440	missense	possibly damaging	0.93
R1617:Urb1	UTSW	16	90760452	missense	possibly damaging	0.82
R1625:Urb1	UTSW	16	90774048	critical splice donor site	probably null
R1640:Urb1	UTSW	16	90772626	missense	probably benign	0.00
R1664:Urb1	UTSW	16	90788082	critical splice donor site	probably null
R1672:Urb1	UTSW	16	90787397	missense	probably damaging	1.00
R1694:Urb1	UTSW	16	90767040	missense	probably benign
R1856:Urb1	UTSW	16	90761695	missense	probably benign	0.00
R2001:Urb1	UTSW	16	90762344	missense	probably benign	0.30
R2196:Urb1	UTSW	16	90774256	missense	probably benign	0.01
R3009:Urb1	UTSW	16	90774798	missense	probably benign	0.09
R3104:Urb1	UTSW	16	90795443	missense	probably damaging	1.00
R3105:Urb1	UTSW	16	90795443	missense	probably damaging	1.00
R3106:Urb1	UTSW	16	90795443	missense	probably damaging	1.00
R3160:Urb1	UTSW	16	90797903	missense	probably damaging	1.00
R3162:Urb1	UTSW	16	90797903	missense	probably damaging	1.00
R3900:Urb1	UTSW	16	90783376	missense	possibly damaging	0.86
R4014:Urb1	UTSW	16	90769465	missense	probably damaging	1.00
R4036:Urb1	UTSW	16	90788086	missense	probably benign
R4332:Urb1	UTSW	16	90774537	missense	probably damaging	1.00
R4448:Urb1	UTSW	16	90769394	missense	possibly damaging	0.71
R4581:Urb1	UTSW	16	90788146	missense	probably benign	0.04
R4593:Urb1	UTSW	16	90787444	missense	probably damaging	1.00
R4610:Urb1	UTSW	16	90776271	missense	probably benign	0.43
R4659:Urb1	UTSW	16	90776129	missense	probably damaging	0.96
R4672:Urb1	UTSW	16	90772634	missense	probably benign
R4681:Urb1	UTSW	16	90804537	missense	probably damaging	0.99
R4771:Urb1	UTSW	16	90753518	missense	probably benign	0.00
R4790:Urb1	UTSW	16	90769555	nonsense	probably null
R4798:Urb1	UTSW	16	90757827	missense	probably benign	0.12
R4809:Urb1	UTSW	16	90759842	missense	possibly damaging	0.82
R4850:Urb1	UTSW	16	90795414	nonsense	probably null
R4916:Urb1	UTSW	16	90783328	missense	probably damaging	1.00
R4969:Urb1	UTSW	16	90805411	missense	probably damaging	1.00
R5032:Urb1	UTSW	16	90756171	missense	probably benign	0.00
R5111:Urb1	UTSW	16	90752017	missense	probably benign	0.00
R5122:Urb1	UTSW	16	90752095	nonsense	probably null
R5184:Urb1	UTSW	16	90783274	critical splice donor site	probably null
R5199:Urb1	UTSW	16	90792748	missense	possibly damaging	0.95
R5436:Urb1	UTSW	16	90792762	missense	probably damaging	1.00
R5767:Urb1	UTSW	16	90776163	missense	probably benign	0.00
R5812:Urb1	UTSW	16	90804537	missense	probably damaging	0.99
R5872:Urb1	UTSW	16	90772764	nonsense	probably null
R6052:Urb1	UTSW	16	90762383	missense	probably damaging	1.00
R6063:Urb1	UTSW	16	90789097	missense	probably benign	0.02
R6065:Urb1	UTSW	16	90803332	missense	probably benign	0.03
R6181:Urb1	UTSW	16	90779094	missense	probably benign	0.00
R6268:Urb1	UTSW	16	90753919	missense	probably benign	0.03
R6429:Urb1	UTSW	16	90762430	splice site	probably null
R6572:Urb1	UTSW	16	90787414	missense	probably benign	0.37
R6606:Urb1	UTSW	16	90810268	missense	probably benign	0.00
R6730:Urb1	UTSW	16	90779083	missense	possibly damaging	0.89
R6838:Urb1	UTSW	16	90782106	missense	possibly damaging	0.93
R7237:Urb1	UTSW	16	90791166	missense	probably damaging	1.00
R7238:Urb1	UTSW	16	90752115	missense	possibly damaging	0.88
R7339:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7341:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7361:Urb1	UTSW	16	90774768	missense	probably damaging	0.99
R7365:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7366:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7440:Urb1	UTSW	16	90787408	missense	probably damaging	1.00
R7530:Urb1	UTSW	16	90761634	missense	probably damaging	1.00
R7553:Urb1	UTSW	16	90792864	missense	probably damaging	1.00
R7557:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7603:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7607:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7609:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7610:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7612:Urb1	UTSW	16	90797910	missense	probably damaging	1.00
R7613:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7684:Urb1	UTSW	16	90786118	nonsense	probably null
R8029:Urb1	UTSW	16	90779152	missense	possibly damaging	0.67
R8324:Urb1	UTSW	16	90791190	missense	probably damaging	1.00
R8680:Urb1	UTSW	16	90774625	missense	probably benign	0.00
R8785:Urb1	UTSW	16	90803423	missense	probably benign	0.07
Z1177:Urb1	UTSW	16	90753883	missense	probably benign	0.00
Z1177:Urb1	UTSW	16	90774862	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TGTTGGCCGCATGAAGCTTC -3'
(R):5'- GAAAGACCCTGGTACAACTGCTG -3'

Sequencing Primer
(F):5'- GCATGAAGCTTCCTTGCG -3'
(R):5'- CTGGTACAACTGCTGGCAAG -3'

Posted On

2014-12-04