Incidental Mutation 'R2850:Stard6'
ID252140
Institutional Source Beutler Lab
Gene Symbol Stard6
Ensembl Gene ENSMUSG00000079608
Gene NameStAR-related lipid transfer (START) domain containing 6
Synonyms1700011K09Rik, 4833424I06Rik, 4933429L05Rik
MMRRC Submission 040443-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R2850 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location70472454-70501066 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70483451 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 60 (H60Q)
Ref Sequence ENSEMBL: ENSMUSP00000134511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114959] [ENSMUST00000164223] [ENSMUST00000168249] [ENSMUST00000173951] [ENSMUST00000174118] [ENSMUST00000174667]
Predicted Effect probably benign
Transcript: ENSMUST00000114959
AA Change: H60Q

PolyPhen 2 Score 0.200 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110609
Gene: ENSMUSG00000079608
AA Change: H60Q

DomainStartEndE-ValueType
START 6 208 8.76e-16 SMART
low complexity region 215 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164223
AA Change: H60Q

PolyPhen 2 Score 0.200 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000126055
Gene: ENSMUSG00000079608
AA Change: H60Q

DomainStartEndE-ValueType
START 6 208 8.76e-16 SMART
low complexity region 215 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168249
AA Change: H60Q

PolyPhen 2 Score 0.200 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130991
Gene: ENSMUSG00000079608
AA Change: H60Q

DomainStartEndE-ValueType
START 6 208 8.76e-16 SMART
low complexity region 215 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173951
SMART Domains Protein: ENSMUSP00000134211
Gene: ENSMUSG00000079608

DomainStartEndE-ValueType
Blast:START 1 54 8e-18 BLAST
PDB:2MOU|A 1 54 3e-17 PDB
SCOP:d1em2a_ 1 54 2e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174118
AA Change: H60Q

PolyPhen 2 Score 0.200 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134511
Gene: ENSMUSG00000079608
AA Change: H60Q

DomainStartEndE-ValueType
START 6 208 8.76e-16 SMART
low complexity region 215 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174667
SMART Domains Protein: ENSMUSP00000133956
Gene: ENSMUSG00000079608

DomainStartEndE-ValueType
Pfam:START 4 98 9.6e-12 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cholesterol homeostasis is regulated, at least in part, by sterol regulatory element (SRE)-binding proteins (e.g., SREBP1; MIM 184756) and by liver X receptors (e.g., LXRA; MIM 602423). Upon sterol depletion, LXRs are inactive and SREBPs are cleaved, after which they bind promoter SREs and activate genes involved in cholesterol biosynthesis and uptake. Sterol transport is mediated by vesicles or by soluble protein carriers, such as steroidogenic acute regulatory protein (STAR; MIM 600617). STAR is homologous to a family of proteins containing a 200- to 210-amino acid STAR-related lipid transfer (START) domain, including STARD6 (Soccio et al., 2002 [PubMed 12011452]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 T A 13: 12,275,179 T734S probably damaging Het
Ago1 T C 4: 126,443,075 probably benign Het
Ahi1 C T 10: 21,000,593 T801I probably benign Het
Alms1 T C 6: 85,621,299 S1505P probably benign Het
Alms1 C A 6: 85,667,963 probably benign Het
Anxa6 T A 11: 55,011,026 Y95F possibly damaging Het
Cacna1b C T 2: 24,761,788 M126I probably damaging Het
Clk1 A G 1: 58,412,279 L457S probably damaging Het
Cngb3 T C 4: 19,415,690 I400T possibly damaging Het
Cntnap5c T A 17: 58,410,348 probably benign Het
Corin A G 5: 72,304,955 V837A probably damaging Het
Ctr9 C T 7: 111,053,446 R984C unknown Het
Cubn G A 2: 13,322,953 T2687I probably damaging Het
Cypt3 T A X: 153,559,278 N168K probably damaging Het
E330020D12Rik A G 1: 153,406,590 noncoding transcript Het
Fbxl4 T C 4: 22,403,624 M399T probably benign Het
Fbxo22 T C 9: 55,223,415 F323L probably damaging Het
Fnip1 A T 11: 54,502,677 E646D probably benign Het
Gid4 G A 11: 60,438,574 probably null Het
Gnb5 A T 9: 75,327,229 D70V probably damaging Het
Gpank1 A G 17: 35,124,581 S346G probably benign Het
Gtf3c6 T C 10: 40,254,258 probably benign Het
Hdx T C X: 111,593,023 I562V probably benign Het
Ifrd2 T C 9: 107,591,709 probably benign Het
Itch A C 2: 155,202,221 Q482P probably benign Het
Kif11 C A 19: 37,409,493 D630E probably benign Het
Lpl G T 8: 68,899,512 E372* probably null Het
Mrps26 T C 2: 130,565,047 V198A probably benign Het
Mucl1 T C 15: 103,752,082 N201S possibly damaging Het
Nedd4 C T 9: 72,725,074 L397F possibly damaging Het
Nfat5 A G 8: 107,293,860 D12G probably damaging Het
Olfr1454 T C 19: 13,063,570 L53P probably damaging Het
Pik3r3 A G 4: 116,270,784 probably benign Het
Pkd1l3 T A 8: 109,623,990 V489E possibly damaging Het
Pkhd1 T C 1: 20,509,076 E1802G possibly damaging Het
Plb1 T A 5: 32,293,224 S370T probably benign Het
Ppat G A 5: 76,919,375 T337I probably benign Het
Prkd3 A G 17: 78,954,596 V763A possibly damaging Het
Prr9 A T 3: 92,123,169 S55T probably benign Het
Rbpms G T 8: 33,834,377 N108K possibly damaging Het
Rc3h2 A T 2: 37,377,415 D972E probably benign Het
Rrbp1 C T 2: 143,949,349 R1378Q probably benign Het
Slc26a7 T A 4: 14,593,806 probably benign Het
Sult6b2 T C 6: 142,797,887 T138A probably benign Het
Th G A 7: 142,894,075 Q329* probably null Het
Tmco3 A G 8: 13,295,024 H268R probably benign Het
Tnn T C 1: 160,139,287 D429G probably benign Het
Tnrc6a G A 7: 123,179,800 G1245R probably damaging Het
Trem3 C A 17: 48,249,641 L47M probably benign Het
Trpm6 T A 19: 18,792,090 C307S possibly damaging Het
Ube2j1 T A 4: 33,049,696 N231K probably benign Het
Urb1 A G 16: 90,774,256 Y1222H probably benign Het
Wdr81 A T 11: 75,451,172 S1090T probably damaging Het
Ythdf3 T C 3: 16,203,818 probably benign Het
Zfp280d A G 9: 72,312,089 T183A probably benign Het
Zfp354c G A 11: 50,815,331 Q306* probably null Het
Zp2 T C 7: 120,138,306 H252R probably benign Het
Other mutations in Stard6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Stard6 APN 18 70483488 missense probably benign 0.00
IGL02403:Stard6 APN 18 70496112 critical splice acceptor site probably null
IGL02934:Stard6 APN 18 70496104 splice site probably benign
IGL03144:Stard6 APN 18 70476111 missense possibly damaging 0.53
R0344:Stard6 UTSW 18 70496115 missense probably damaging 1.00
R2896:Stard6 UTSW 18 70476388 missense probably benign 0.02
R3236:Stard6 UTSW 18 70500486 missense probably damaging 0.99
R4532:Stard6 UTSW 18 70483534 missense probably damaging 1.00
R4959:Stard6 UTSW 18 70498560 missense possibly damaging 0.92
R4973:Stard6 UTSW 18 70498560 missense possibly damaging 0.92
R5080:Stard6 UTSW 18 70496222 missense probably damaging 1.00
R6380:Stard6 UTSW 18 70476388 missense probably benign 0.02
R7331:Stard6 UTSW 18 70483482 missense probably damaging 1.00
R7396:Stard6 UTSW 18 70500435 missense possibly damaging 0.95
R7399:Stard6 UTSW 18 70498647 splice site probably null
R8002:Stard6 UTSW 18 70500526 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- AACCAAGGTCTGTCTGTGTG -3'
(R):5'- AATGGTCCTTGGTTCAGTCC -3'

Sequencing Primer
(F):5'- CAAGGTCTGTCTGTGTGTGTATATAC -3'
(R):5'- GTCCTTGGTTCAGTCCCCAAC -3'
Posted On2014-12-04