Incidental Mutation 'R2850:Olfr1454'
ID252142
Institutional Source Beutler Lab
Gene Symbol Olfr1454
Ensembl Gene ENSMUSG00000094986
Gene Nameolfactory receptor 1454
SynonymsMOR202-14, GA_x6K02T2RE5P-3390804-3391727
MMRRC Submission 040443-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R2850 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13060610-13067157 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13063570 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 53 (L53P)
Ref Sequence ENSEMBL: ENSMUSP00000148859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073732] [ENSMUST00000213806] [ENSMUST00000214695] [ENSMUST00000217568]
Predicted Effect probably damaging
Transcript: ENSMUST00000073732
AA Change: L53P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073409
Gene: ENSMUSG00000094986
AA Change: L53P

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.1e-50 PFAM
Pfam:7tm_1 39 288 2.7e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213806
AA Change: L53P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214695
AA Change: L53P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217568
AA Change: L53P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 T A 13: 12,275,179 T734S probably damaging Het
Ago1 T C 4: 126,443,075 probably benign Het
Ahi1 C T 10: 21,000,593 T801I probably benign Het
Alms1 T C 6: 85,621,299 S1505P probably benign Het
Alms1 C A 6: 85,667,963 probably benign Het
Anxa6 T A 11: 55,011,026 Y95F possibly damaging Het
Cacna1b C T 2: 24,761,788 M126I probably damaging Het
Clk1 A G 1: 58,412,279 L457S probably damaging Het
Cngb3 T C 4: 19,415,690 I400T possibly damaging Het
Cntnap5c T A 17: 58,410,348 probably benign Het
Corin A G 5: 72,304,955 V837A probably damaging Het
Ctr9 C T 7: 111,053,446 R984C unknown Het
Cubn G A 2: 13,322,953 T2687I probably damaging Het
Cypt3 T A X: 153,559,278 N168K probably damaging Het
E330020D12Rik A G 1: 153,406,590 noncoding transcript Het
Fbxl4 T C 4: 22,403,624 M399T probably benign Het
Fbxo22 T C 9: 55,223,415 F323L probably damaging Het
Fnip1 A T 11: 54,502,677 E646D probably benign Het
Gid4 G A 11: 60,438,574 probably null Het
Gnb5 A T 9: 75,327,229 D70V probably damaging Het
Gpank1 A G 17: 35,124,581 S346G probably benign Het
Gtf3c6 T C 10: 40,254,258 probably benign Het
Hdx T C X: 111,593,023 I562V probably benign Het
Ifrd2 T C 9: 107,591,709 probably benign Het
Itch A C 2: 155,202,221 Q482P probably benign Het
Kif11 C A 19: 37,409,493 D630E probably benign Het
Lpl G T 8: 68,899,512 E372* probably null Het
Mrps26 T C 2: 130,565,047 V198A probably benign Het
Mucl1 T C 15: 103,752,082 N201S possibly damaging Het
Nedd4 C T 9: 72,725,074 L397F possibly damaging Het
Nfat5 A G 8: 107,293,860 D12G probably damaging Het
Pik3r3 A G 4: 116,270,784 probably benign Het
Pkd1l3 T A 8: 109,623,990 V489E possibly damaging Het
Pkhd1 T C 1: 20,509,076 E1802G possibly damaging Het
Plb1 T A 5: 32,293,224 S370T probably benign Het
Ppat G A 5: 76,919,375 T337I probably benign Het
Prkd3 A G 17: 78,954,596 V763A possibly damaging Het
Prr9 A T 3: 92,123,169 S55T probably benign Het
Rbpms G T 8: 33,834,377 N108K possibly damaging Het
Rc3h2 A T 2: 37,377,415 D972E probably benign Het
Rrbp1 C T 2: 143,949,349 R1378Q probably benign Het
Slc26a7 T A 4: 14,593,806 probably benign Het
Stard6 T A 18: 70,483,451 H60Q probably benign Het
Sult6b2 T C 6: 142,797,887 T138A probably benign Het
Th G A 7: 142,894,075 Q329* probably null Het
Tmco3 A G 8: 13,295,024 H268R probably benign Het
Tnn T C 1: 160,139,287 D429G probably benign Het
Tnrc6a G A 7: 123,179,800 G1245R probably damaging Het
Trem3 C A 17: 48,249,641 L47M probably benign Het
Trpm6 T A 19: 18,792,090 C307S possibly damaging Het
Ube2j1 T A 4: 33,049,696 N231K probably benign Het
Urb1 A G 16: 90,774,256 Y1222H probably benign Het
Wdr81 A T 11: 75,451,172 S1090T probably damaging Het
Ythdf3 T C 3: 16,203,818 probably benign Het
Zfp280d A G 9: 72,312,089 T183A probably benign Het
Zfp354c G A 11: 50,815,331 Q306* probably null Het
Zp2 T C 7: 120,138,306 H252R probably benign Het
Other mutations in Olfr1454
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Olfr1454 APN 19 13064149 missense probably damaging 1.00
IGL02942:Olfr1454 APN 19 13064188 missense probably benign 0.45
IGL03331:Olfr1454 APN 19 13063867 missense probably damaging 1.00
R0551:Olfr1454 UTSW 19 13064294 missense probably benign 0.01
R0738:Olfr1454 UTSW 19 13063738 missense probably damaging 1.00
R1532:Olfr1454 UTSW 19 13064275 missense probably damaging 1.00
R2072:Olfr1454 UTSW 19 13063680 missense probably benign 0.00
R2092:Olfr1454 UTSW 19 13063802 nonsense probably null
R2656:Olfr1454 UTSW 19 13063984 missense probably benign 0.05
R4212:Olfr1454 UTSW 19 13063759 missense probably damaging 0.98
R5303:Olfr1454 UTSW 19 13063775 nonsense probably null
R6362:Olfr1454 UTSW 19 13063345 start gained probably benign
R6928:Olfr1454 UTSW 19 13063984 missense probably benign 0.05
R7183:Olfr1454 UTSW 19 13064316 missense probably benign 0.00
R7701:Olfr1454 UTSW 19 13064081 missense probably damaging 1.00
R7741:Olfr1454 UTSW 19 13064059 missense probably damaging 0.98
R8057:Olfr1454 UTSW 19 13063274 start gained probably benign
Z1176:Olfr1454 UTSW 19 13063646 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- AACTGATATCACTGATGGAGAACAG -3'
(R):5'- TGTAGGGGCTTACATACTGCTAC -3'

Sequencing Primer
(F):5'- GAACAGAAGTGAGATGCTTCATCCTG -3'
(R):5'- GGGGCTTACATACTGCTACATAACG -3'
Posted On2014-12-04