Incidental Mutation 'R2504:Usp47'
ID252159
Institutional Source Beutler Lab
Gene Symbol Usp47
Ensembl Gene ENSMUSG00000059263
Gene Nameubiquitin specific peptidase 47
SynonymsA630020C16Rik, 4930502N04Rik
MMRRC Submission 040412-MU
Accession Numbers

Genbank: NM_133758; MGI: 1922246

Is this an essential gene? Possibly essential (E-score: 0.688) question?
Stock #R2504 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location112023504-112111661 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 112104470 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106653] [ENSMUST00000106653] [ENSMUST00000210309] [ENSMUST00000210309] [ENSMUST00000215510]
Predicted Effect probably null
Transcript: ENSMUST00000106653
SMART Domains Protein: ENSMUSP00000102264
Gene: ENSMUSG00000059263

DomainStartEndE-ValueType
Pfam:UCH 167 541 1.2e-50 PFAM
Pfam:UCH_1 168 507 5.1e-31 PFAM
coiled coil region 554 586 N/A INTRINSIC
low complexity region 859 880 N/A INTRINSIC
low complexity region 934 950 N/A INTRINSIC
Pfam:Ubiquitin_2 1026 1095 1.9e-3 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106653
SMART Domains Protein: ENSMUSP00000102264
Gene: ENSMUSG00000059263

DomainStartEndE-ValueType
Pfam:UCH 167 541 1.2e-50 PFAM
Pfam:UCH_1 168 507 5.1e-31 PFAM
coiled coil region 554 586 N/A INTRINSIC
low complexity region 859 880 N/A INTRINSIC
low complexity region 934 950 N/A INTRINSIC
Pfam:Ubiquitin_2 1026 1095 1.9e-3 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000210309
Predicted Effect probably null
Transcript: ENSMUST00000210309
Predicted Effect probably null
Transcript: ENSMUST00000215510
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mouse embryonic fibroblasts from mice homozygous for a gene trap allele exhibit increased sensitivity to UV irradiation. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,219,216 E1750K probably damaging Het
4933425L06Rik A G 13: 105,109,742 I270M probably benign Het
Aatk T C 11: 120,018,855 D28G probably benign Het
Abcg1 T A 17: 31,092,395 S125T probably damaging Het
Actbl2 T C 13: 111,256,183 S351P possibly damaging Het
Ankrd34b A G 13: 92,439,061 probably null Het
BC030867 T C 11: 102,255,296 Y133H possibly damaging Het
BC051665 C T 13: 60,782,654 V295I probably benign Het
C1qtnf2 A G 11: 43,491,156 N265S probably damaging Het
Ccdc14 C T 16: 34,721,850 R573* probably null Het
Cd55b A T 1: 130,409,875 Y247N probably damaging Het
Celsr2 A T 3: 108,413,591 V635E probably benign Het
Clec16a T C 16: 10,559,687 probably benign Het
Clec4b1 A G 6: 123,065,945 Y41C probably damaging Het
Cntn5 A T 9: 10,172,121 D19E probably benign Het
Cop1 A G 1: 159,232,805 N53S probably damaging Het
Csad A T 15: 102,188,667 M1K probably null Het
Cyb5rl A G 4: 107,080,945 I200V probably benign Het
Cyp26a1 A G 19: 37,698,342 T81A probably damaging Het
Cyp2d12 A T 15: 82,559,036 H433L probably benign Het
D7Ertd443e T A 7: 134,349,479 probably null Het
Dennd1b A G 1: 139,170,170 probably benign Het
Dmap1 G T 4: 117,675,298 T357K probably damaging Het
Dzip1 G T 14: 118,881,044 T759K probably benign Het
Elmo2 A G 2: 165,298,687 V300A probably damaging Het
Eml5 T C 12: 98,844,105 D864G possibly damaging Het
Ep400 A G 5: 110,668,645 V2670A probably damaging Het
Epha3 T A 16: 63,603,625 I534F probably damaging Het
Epha4 A C 1: 77,382,991 Y742D probably damaging Het
Ergic2 A G 6: 148,204,774 probably null Het
Ero1l A T 14: 45,299,088 probably null Het
Fam229a A G 4: 129,491,486 D70G probably damaging Het
Fbn2 C T 18: 58,093,359 R781Q probably damaging Het
Fbxo16 A T 14: 65,270,714 probably benign Het
Fbxo39 T A 11: 72,317,285 S154R probably benign Het
Fer T A 17: 63,991,580 probably null Het
Filip1l A G 16: 57,570,662 I538V possibly damaging Het
Filip1l A T 16: 57,571,047 D428V probably damaging Het
Fsip2 T C 2: 82,979,610 I2091T possibly damaging Het
Glyat A C 19: 12,651,398 T186P possibly damaging Het
Gm10604 A G 4: 11,980,083 S74P unknown Het
Gm4787 T G 12: 81,379,137 K82N possibly damaging Het
Hectd4 T C 5: 121,220,620 I50T unknown Het
Hectd4 T C 5: 121,263,967 S373P possibly damaging Het
Hmcn1 A T 1: 150,686,867 C2313* probably null Het
Igfn1 A T 1: 135,969,316 S1171T probably benign Het
Ints8 T C 4: 11,241,642 D267G probably benign Het
Itln1 A G 1: 171,529,159 C251R probably damaging Het
Jcad C T 18: 4,674,026 T596M probably damaging Het
Kcnj16 C T 11: 111,025,583 T357M probably benign Het
Kif13a G A 13: 46,814,200 T346M probably damaging Het
Klhl24 G A 16: 20,120,167 A491T probably benign Het
Kntc1 C T 5: 123,778,347 Q748* probably null Het
Krt25 T A 11: 99,317,296 K369* probably null Het
Krt75 C T 15: 101,568,031 R433Q probably benign Het
Krt76 A G 15: 101,884,858 F582L unknown Het
Lysmd1 G A 3: 95,138,397 V182I probably benign Het
Mab21l2 T A 3: 86,547,555 E46V probably damaging Het
Magi2 A T 5: 20,358,936 K355N probably damaging Het
March10 T C 11: 105,385,572 D630G probably damaging Het
Mast4 A T 13: 102,738,639 I1215N probably damaging Het
Nckap1 G A 2: 80,530,218 T523I probably benign Het
Nexmif T A X: 104,084,393 D1306V probably damaging Het
Nfkb1 A C 3: 135,589,329 I918R possibly damaging Het
Nup50 A T 15: 84,933,658 T93S probably benign Het
Nwd2 T C 5: 63,804,374 Y434H probably benign Het
Olfr61 T C 7: 140,638,484 V261A probably benign Het
Osbpl1a C A 18: 12,905,031 V288L probably benign Het
Pan3 A G 5: 147,527,036 E562G possibly damaging Het
Pappa T A 4: 65,180,889 Y548* probably null Het
Phf3 A T 1: 30,810,789 L1181Q probably damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Pkhd1l1 T C 15: 44,485,428 I240T probably damaging Het
Pole G A 5: 110,290,502 probably null Het
Polq T A 16: 37,011,942 S15T unknown Het
Prrt2 T C 7: 127,020,224 E23G possibly damaging Het
Prss37 A T 6: 40,517,826 probably null Het
Prune2 T C 19: 17,000,036 L45P probably damaging Het
Psd A T 19: 46,324,913 M6K possibly damaging Het
Psmd1 A G 1: 86,089,997 E510G possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Pxdn T A 12: 30,003,406 I1194N probably damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rgmb C A 17: 15,807,647 R270L probably benign Het
Rpgrip1l A G 8: 91,280,716 probably null Het
Rps2 G A 17: 24,720,379 probably benign Het
Rsbn1l G T 5: 20,902,366 A550E probably damaging Het
S1pr4 C T 10: 81,499,304 R112H probably benign Het
Scfd2 T C 5: 74,531,177 N148S probably damaging Het
Scin C T 12: 40,081,706 M276I probably benign Het
Sec24d T C 3: 123,353,606 I708T possibly damaging Het
Skint11 T A 4: 114,228,812 F41I possibly damaging Het
Slc15a4 A T 5: 127,617,239 F44Y possibly damaging Het
Slc6a18 A G 13: 73,675,806 Y72H probably benign Het
Slc7a11 A T 3: 50,377,746 probably null Het
Slc7a14 G T 3: 31,237,501 N209K possibly damaging Het
Sstr2 T C 11: 113,624,431 C59R probably damaging Het
Stab1 A G 14: 31,163,040 probably null Het
Stag1 G T 9: 100,866,210 S475I probably damaging Het
Stxbp5l A G 16: 37,115,667 Y1183H probably damaging Het
Svep1 A T 4: 58,135,628 probably null Het
Tm9sf2 A G 14: 122,158,684 T653A probably benign Het
Tmeff1 T C 4: 48,662,059 S366P possibly damaging Het
Tnnt2 G T 1: 135,852,065 W300L probably damaging Het
Traj32 A G 14: 54,186,103 probably benign Het
Trp53bp2 A T 1: 182,441,639 M223L probably benign Het
Tsga10 G A 1: 37,815,677 T246M probably damaging Het
Txn2 A T 15: 77,926,670 probably benign Het
Ubr3 T A 2: 69,938,198 F450I probably damaging Het
Vars2 C T 17: 35,664,793 R244Q probably damaging Het
Xrra1 T A 7: 99,897,596 F251L probably damaging Het
Zfp804a G A 2: 82,257,519 R564Q probably benign Het
Zfp983 T C 17: 21,658,967 C29R probably damaging Het
Other mutations in Usp47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Usp47 APN 7 112074783 missense probably benign 0.00
IGL00574:Usp47 APN 7 112063335 missense probably damaging 1.00
IGL00975:Usp47 APN 7 112093370 missense probably damaging 1.00
IGL01289:Usp47 APN 7 112063358 missense probably damaging 1.00
IGL01419:Usp47 APN 7 112087911 missense possibly damaging 0.94
IGL01645:Usp47 APN 7 112054862 missense probably damaging 0.96
IGL01871:Usp47 APN 7 112077786 splice site probably benign
IGL02066:Usp47 APN 7 112064397 missense probably damaging 1.00
IGL02122:Usp47 APN 7 112106908 missense probably damaging 0.97
IGL02153:Usp47 APN 7 112104049 missense probably benign 0.00
IGL02550:Usp47 APN 7 112104354 missense probably damaging 1.00
IGL02710:Usp47 APN 7 112092925 missense probably benign 0.01
IGL02756:Usp47 APN 7 112093063 missense possibly damaging 0.76
IGL03093:Usp47 APN 7 112089620 missense probably damaging 1.00
IGL03398:Usp47 APN 7 112074503 missense probably damaging 1.00
0152:Usp47 UTSW 7 112056577 missense probably damaging 0.96
PIT4142001:Usp47 UTSW 7 112104341 splice site probably benign
R0110:Usp47 UTSW 7 112056580 missense possibly damaging 0.88
R0381:Usp47 UTSW 7 112063393 critical splice donor site probably null
R0450:Usp47 UTSW 7 112056580 missense possibly damaging 0.88
R0634:Usp47 UTSW 7 112108655 missense probably damaging 1.00
R0881:Usp47 UTSW 7 112091436 missense possibly damaging 0.51
R1178:Usp47 UTSW 7 112109998 missense possibly damaging 0.68
R1447:Usp47 UTSW 7 112074568 critical splice donor site probably null
R1640:Usp47 UTSW 7 112083127 missense probably damaging 0.99
R1727:Usp47 UTSW 7 112086100 missense probably damaging 0.96
R1866:Usp47 UTSW 7 112101870 missense possibly damaging 0.93
R1876:Usp47 UTSW 7 112054920 missense probably damaging 0.99
R1953:Usp47 UTSW 7 112092876 missense probably benign 0.26
R2117:Usp47 UTSW 7 112067236 critical splice donor site probably null
R2176:Usp47 UTSW 7 112092727 missense probably benign 0.00
R2187:Usp47 UTSW 7 112067191 missense probably damaging 1.00
R2902:Usp47 UTSW 7 112093451 missense probably damaging 1.00
R2922:Usp47 UTSW 7 112093198 missense probably damaging 1.00
R2939:Usp47 UTSW 7 112082536 missense probably damaging 1.00
R4065:Usp47 UTSW 7 112053416 missense probably benign 0.30
R4179:Usp47 UTSW 7 112087884 missense probably damaging 1.00
R4235:Usp47 UTSW 7 112110048 missense probably damaging 0.99
R4243:Usp47 UTSW 7 112108629 missense probably damaging 1.00
R4281:Usp47 UTSW 7 112109993 missense probably benign 0.03
R4360:Usp47 UTSW 7 112054932 missense probably damaging 1.00
R4604:Usp47 UTSW 7 112101831 missense probably damaging 1.00
R4857:Usp47 UTSW 7 112082552 missense probably damaging 1.00
R5133:Usp47 UTSW 7 112083882 missense probably damaging 1.00
R5179:Usp47 UTSW 7 112093432 missense probably damaging 1.00
R5322:Usp47 UTSW 7 112053269 missense probably damaging 0.99
R5445:Usp47 UTSW 7 112074721 missense probably damaging 1.00
R5465:Usp47 UTSW 7 112059002 missense probably damaging 1.00
R5699:Usp47 UTSW 7 112109997 missense probably benign 0.00
R5961:Usp47 UTSW 7 112053316 missense probably damaging 1.00
R6117:Usp47 UTSW 7 112087932 missense probably damaging 0.98
R6271:Usp47 UTSW 7 112087056 missense probably damaging 1.00
R7155:Usp47 UTSW 7 112087013 missense probably damaging 0.97
R7229:Usp47 UTSW 7 112092877 missense probably benign 0.04
R7285:Usp47 UTSW 7 112093108 missense probably benign 0.02
RF010:Usp47 UTSW 7 112092938 missense probably damaging 0.99
X0027:Usp47 UTSW 7 112087847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACAGTTGATTTTGGGTGTCA -3'
(R):5'- TGCAAACAGCTAAATTAGGGACAA -3'

Sequencing Primer
(F):5'- GATTTTGGGTGTCAATTAATGTAGC -3'
(R):5'- CAGCTAAATTAGGGACAAGGAAAG -3'
Posted On2014-12-04