Incidental Mutation 'R0311:Pym1'
ID25216
Institutional Source Beutler Lab
Gene Symbol Pym1
Ensembl Gene ENSMUSG00000064030
Gene NamePYM homolog 1, exon junction complex associated factor
SynonymsPYM Protein, Wibg, A030010B05Rik, Pym
MMRRC Submission 038521-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.903) question?
Stock #R0311 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location128747889-128766564 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 128765984 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 168 (R168L)
Ref Sequence ENSEMBL: ENSMUSP00000067623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065210] [ENSMUST00000163377] [ENSMUST00000218218]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065210
AA Change: R168L

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000067623
Gene: ENSMUSG00000064030
AA Change: R168L

DomainStartEndE-ValueType
Mago-bind 11 37 1.22e-11 SMART
coiled coil region 81 116 N/A INTRINSIC
coiled coil region 143 174 N/A INTRINSIC
low complexity region 182 202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163377
AA Change: R169L

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000129789
Gene: ENSMUSG00000064030
AA Change: R169L

DomainStartEndE-ValueType
Mago-bind 12 38 4.57e-11 SMART
coiled coil region 82 117 N/A INTRINSIC
coiled coil region 144 175 N/A INTRINSIC
low complexity region 183 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218218
Meta Mutation Damage Score 0.0749 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.6%
  • 20x: 91.6%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A C 7: 120,402,904 M1547L probably damaging Het
Abcb4 A G 5: 8,934,243 K658E probably benign Het
Abr A G 11: 76,509,127 S15P possibly damaging Het
Adgrb2 G C 4: 130,017,129 A1168P probably damaging Het
Adgre4 A T 17: 55,802,010 E339V probably benign Het
Asprv1 T C 6: 86,628,840 W223R probably damaging Het
Ccdc89 A G 7: 90,426,693 E37G probably damaging Het
Cd48 C A 1: 171,699,580 Y191* probably null Het
Chd4 T C 6: 125,101,665 I257T probably benign Het
Clca4b T C 3: 144,932,496 M2V probably benign Het
Dnah11 A T 12: 118,127,133 D1025E probably benign Het
Erich5 A G 15: 34,472,939 *363W probably null Het
Etl4 A G 2: 20,807,129 D1341G probably damaging Het
Fbxw11 A G 11: 32,722,083 T184A probably benign Het
Fktn A G 4: 53,744,620 Q300R probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gdpd3 G A 7: 126,767,189 R66Q possibly damaging Het
Hexb A G 13: 97,183,819 probably benign Het
Kdm4b A G 17: 56,386,200 R346G probably benign Het
Mbtd1 T A 11: 93,921,357 probably null Het
Med23 T A 10: 24,897,358 C653S possibly damaging Het
Nwd2 A T 5: 63,804,998 I642L probably damaging Het
Olfr1444 A G 19: 12,861,869 I31M probably benign Het
Olfr1448 T A 19: 12,920,096 Y71F possibly damaging Het
Olfr912 T C 9: 38,539,297 V134A probably benign Het
Pbld2 T C 10: 63,054,507 probably null Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Plpp2 C T 10: 79,527,580 R77K probably damaging Het
Rbm4 T C 19: 4,787,556 Y300C probably damaging Het
Rnf207 A G 4: 152,315,779 C175R probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Speg T C 1: 75,430,937 V3196A probably damaging Het
Syne1 T A 10: 5,348,943 I1048L possibly damaging Het
Th T C 7: 142,896,041 E41G probably damaging Het
Tmx4 T A 2: 134,598,526 *336L probably null Het
Tnfrsf18 T C 4: 156,026,415 V10A possibly damaging Het
Tnxb A T 17: 34,716,984 I2670F probably damaging Het
Tpx2 T C 2: 152,890,492 V562A probably damaging Het
Vmn2r73 A G 7: 85,871,789 S324P probably benign Het
Vps18 T C 2: 119,297,365 Y890H probably benign Het
Ythdc1 G A 5: 86,835,705 D670N probably damaging Het
Other mutations in Pym1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1822:Pym1 UTSW 10 128766044 utr 3 prime probably benign
R1823:Pym1 UTSW 10 128766044 utr 3 prime probably benign
R3619:Pym1 UTSW 10 128765204 missense probably damaging 1.00
Z1177:Pym1 UTSW 10 128765944 frame shift probably null
Z1177:Pym1 UTSW 10 128765952 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACAGCCCAGATACCTAGTGCTCTC -3'
(R):5'- TGCTATACCCTCAGCCTCAGATCG -3'

Sequencing Primer
(F):5'- GATACCTAGTGCTCTCCAAGG -3'
(R):5'- TCGGCACTCAGATTGTGAAC -3'
Posted On2013-04-16