Incidental Mutation 'R0311:Fbxw11'
ID25218
Institutional Source Beutler Lab
Gene Symbol Fbxw11
Ensembl Gene ENSMUSG00000020271
Gene NameF-box and WD-40 domain protein 11
SynonymsHOS, 2310065A07Rik, Fbxw1b, BTRC2, BTRCP2
MMRRC Submission 038521-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R0311 (G1)
Quality Score224
Status Validated
Chromosome11
Chromosomal Location32642724-32746816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32722083 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 184 (T184A)
Ref Sequence ENSEMBL: ENSMUSP00000104991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076383] [ENSMUST00000093205] [ENSMUST00000109366]
Predicted Effect probably benign
Transcript: ENSMUST00000076383
AA Change: T218A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075721
Gene: ENSMUSG00000020271
AA Change: T218A

DomainStartEndE-ValueType
Beta-TrCP_D 98 137 5.48e-26 SMART
FBOX 149 188 5.08e-6 SMART
WD40 250 287 6.89e-3 SMART
WD40 290 327 3.78e-9 SMART
WD40 330 367 7.73e-6 SMART
WD40 373 410 9.67e-7 SMART
WD40 413 450 3.93e-7 SMART
WD40 453 490 8.42e-7 SMART
WD40 502 539 2.48e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093205
AA Change: T197A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090893
Gene: ENSMUSG00000020271
AA Change: T197A

DomainStartEndE-ValueType
Beta-TrCP_D 77 116 5.48e-26 SMART
FBOX 128 167 5.08e-6 SMART
WD40 229 266 6.89e-3 SMART
WD40 269 306 3.78e-9 SMART
WD40 309 346 7.73e-6 SMART
WD40 352 389 9.67e-7 SMART
WD40 392 429 3.93e-7 SMART
WD40 432 469 8.42e-7 SMART
WD40 481 518 2.48e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109366
AA Change: T184A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104991
Gene: ENSMUSG00000020271
AA Change: T184A

DomainStartEndE-ValueType
Beta-TrCP_D 64 103 5.48e-26 SMART
FBOX 115 154 5.08e-6 SMART
WD40 216 253 6.89e-3 SMART
WD40 256 293 3.78e-9 SMART
WD40 296 333 7.73e-6 SMART
WD40 339 376 9.67e-7 SMART
WD40 379 416 3.93e-7 SMART
WD40 419 456 8.42e-7 SMART
WD40 468 505 2.48e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143290
Meta Mutation Damage Score 0.0581 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.6%
  • 20x: 91.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbws class and, in addition to an F-box, contains multiple WD40 repeats. This gene contains at least 14 exons, and its alternative splicing generates 3 transcript variants diverging at the presence/absence of two alternate exons. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A C 7: 120,402,904 M1547L probably damaging Het
Abcb4 A G 5: 8,934,243 K658E probably benign Het
Abr A G 11: 76,509,127 S15P possibly damaging Het
Adgrb2 G C 4: 130,017,129 A1168P probably damaging Het
Adgre4 A T 17: 55,802,010 E339V probably benign Het
Asprv1 T C 6: 86,628,840 W223R probably damaging Het
Ccdc89 A G 7: 90,426,693 E37G probably damaging Het
Cd48 C A 1: 171,699,580 Y191* probably null Het
Chd4 T C 6: 125,101,665 I257T probably benign Het
Clca4b T C 3: 144,932,496 M2V probably benign Het
Dnah11 A T 12: 118,127,133 D1025E probably benign Het
Erich5 A G 15: 34,472,939 *363W probably null Het
Etl4 A G 2: 20,807,129 D1341G probably damaging Het
Fktn A G 4: 53,744,620 Q300R probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gdpd3 G A 7: 126,767,189 R66Q possibly damaging Het
Hexb A G 13: 97,183,819 probably benign Het
Kdm4b A G 17: 56,386,200 R346G probably benign Het
Mbtd1 T A 11: 93,921,357 probably null Het
Med23 T A 10: 24,897,358 C653S possibly damaging Het
Nwd2 A T 5: 63,804,998 I642L probably damaging Het
Olfr1444 A G 19: 12,861,869 I31M probably benign Het
Olfr1448 T A 19: 12,920,096 Y71F possibly damaging Het
Olfr912 T C 9: 38,539,297 V134A probably benign Het
Pbld2 T C 10: 63,054,507 probably null Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plpp2 C T 10: 79,527,580 R77K probably damaging Het
Pym1 G T 10: 128,765,984 R168L possibly damaging Het
Rbm4 T C 19: 4,787,556 Y300C probably damaging Het
Rnf207 A G 4: 152,315,779 C175R probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Speg T C 1: 75,430,937 V3196A probably damaging Het
Syne1 T A 10: 5,348,943 I1048L possibly damaging Het
Th T C 7: 142,896,041 E41G probably damaging Het
Tmx4 T A 2: 134,598,526 *336L probably null Het
Tnfrsf18 T C 4: 156,026,415 V10A possibly damaging Het
Tnxb A T 17: 34,716,984 I2670F probably damaging Het
Tpx2 T C 2: 152,890,492 V562A probably damaging Het
Vmn2r73 A G 7: 85,871,789 S324P probably benign Het
Vps18 T C 2: 119,297,365 Y890H probably benign Het
Ythdc1 G A 5: 86,835,705 D670N probably damaging Het
Other mutations in Fbxw11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:Fbxw11 APN 11 32722101 missense possibly damaging 0.94
IGL01828:Fbxw11 APN 11 32720505 missense probably damaging 1.00
PIT4651001:Fbxw11 UTSW 11 32711999 critical splice donor site probably null
R0331:Fbxw11 UTSW 11 32711895 missense probably damaging 0.99
R0597:Fbxw11 UTSW 11 32720496 missense probably damaging 1.00
R0989:Fbxw11 UTSW 11 32735149 missense probably benign 0.17
R1175:Fbxw11 UTSW 11 32711922 missense probably damaging 0.96
R1327:Fbxw11 UTSW 11 32711859 missense probably benign 0.00
R1589:Fbxw11 UTSW 11 32733612 missense probably damaging 1.00
R3155:Fbxw11 UTSW 11 32739244 missense possibly damaging 0.93
R4084:Fbxw11 UTSW 11 32739248 missense probably damaging 1.00
R4610:Fbxw11 UTSW 11 32711859 missense possibly damaging 0.48
R4677:Fbxw11 UTSW 11 32742535 nonsense probably null
R4694:Fbxw11 UTSW 11 32642820 unclassified probably benign
R4946:Fbxw11 UTSW 11 32739226 missense probably damaging 1.00
R5027:Fbxw11 UTSW 11 32652811 intron probably benign
R5345:Fbxw11 UTSW 11 32738471 missense probably damaging 1.00
R5459:Fbxw11 UTSW 11 32739191 missense possibly damaging 0.85
R5802:Fbxw11 UTSW 11 32711790 missense probably benign 0.18
R5820:Fbxw11 UTSW 11 32735374 missense probably damaging 1.00
R6181:Fbxw11 UTSW 11 32742575 missense probably benign
R6365:Fbxw11 UTSW 11 32720623 missense possibly damaging 0.75
R6948:Fbxw11 UTSW 11 32742597 missense probably damaging 0.98
R7251:Fbxw11 UTSW 11 32731370 missense probably benign 0.00
R7475:Fbxw11 UTSW 11 32711999 critical splice donor site probably null
X0064:Fbxw11 UTSW 11 32711859 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAGCATCGTGCCAGAACTAGATTG -3'
(R):5'- TGGCAGCCTTACAGAAGCATTTCG -3'

Sequencing Primer
(F):5'- GTGCCAGAACTAGATTGTCTCTAC -3'
(R):5'- TGTGATCAGCTCTGAAGAACAGC -3'
Posted On2013-04-16