Incidental Mutation 'R2851:Depdc5'
ID252196
Institutional Source Beutler Lab
Gene Symbol Depdc5
Ensembl Gene ENSMUSG00000037426
Gene NameDEP domain containing 5
Synonyms
MMRRC Submission 040444-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2851 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location32863701-32994236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32924171 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 559 (E559G)
Ref Sequence ENSEMBL: ENSMUSP00000113980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049780] [ENSMUST00000087897] [ENSMUST00000119705] [ENSMUST00000120902] [ENSMUST00000124780] [ENSMUST00000195980]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049780
AA Change: E559G

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000052807
Gene: ENSMUSG00000037426
AA Change: E559G

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-64 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000087897
AA Change: E559G

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000085207
Gene: ENSMUSG00000037426
AA Change: E559G

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 2.3e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 826 836 N/A INTRINSIC
low complexity region 994 1006 N/A INTRINSIC
low complexity region 1159 1175 N/A INTRINSIC
DEP 1184 1259 2.49e-15 SMART
low complexity region 1322 1335 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119705
AA Change: E559G

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113862
Gene: ENSMUSG00000037426
AA Change: E559G

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3e-117 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1150 1166 N/A INTRINSIC
DEP 1175 1250 2.49e-15 SMART
low complexity region 1313 1326 N/A INTRINSIC
low complexity region 1511 1525 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120902
AA Change: E559G

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113980
Gene: ENSMUSG00000037426
AA Change: E559G

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1128 1144 N/A INTRINSIC
DEP 1153 1228 2.49e-15 SMART
low complexity region 1291 1304 N/A INTRINSIC
low complexity region 1489 1503 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124780
SMART Domains Protein: ENSMUSP00000120120
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
low complexity region 179 189 N/A INTRINSIC
low complexity region 347 359 N/A INTRINSIC
SCOP:d1fsha_ 519 586 1e-13 SMART
Blast:DEP 537 589 2e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000137169
SMART Domains Protein: ENSMUSP00000121089
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
low complexity region 54 65 N/A INTRINSIC
low complexity region 88 97 N/A INTRINSIC
low complexity region 224 234 N/A INTRINSIC
low complexity region 392 404 N/A INTRINSIC
low complexity region 535 551 N/A INTRINSIC
DEP 560 635 2.49e-15 SMART
low complexity region 698 711 N/A INTRINSIC
low complexity region 896 910 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195980
SMART Domains Protein: ENSMUSP00000143228
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 147 4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201802
Meta Mutation Damage Score 0.1317 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IML1 family of proteins involved in G-protein signaling pathways. The mechanistic target of rapamycin complex 1 (mTORC1) pathway regulates cell growth by sensing the availability of nutrients. The protein encoded by this gene is a component of the GATOR1 (GAP activity toward Rags) complex which inhibits the amino acid-sensing branch of the mTORC1 pathway. Mutations in this gene are associated with autosomal dominant familial focal epilepsy with variable foci. A single nucleotide polymorphism in an intron of this gene has been associated with an increased risk of hepatocellular carcinoma in individuals with chronic hepatitis C virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in neurons exhibit reduced body weight, limb grasping, premature death, spontaneous seizure, increased brain size due to neuron hypertrophy and increased PTZ seizure susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2cl T C 9: 110,894,135 S636P probably damaging Het
Arhgef4 A C 1: 34,724,048 D795A unknown Het
Bank1 A T 3: 136,242,940 S159T possibly damaging Het
Catsperd A G 17: 56,660,169 probably null Het
Ccdc85a A G 11: 28,392,942 probably benign Het
Ceacam11 T C 7: 17,978,526 I300T probably benign Het
Cmtm5 A G 14: 54,938,055 probably benign Het
Cnn3 C T 3: 121,450,053 probably benign Het
Col12a1 A T 9: 79,678,332 N1254K probably damaging Het
Crispld2 T A 8: 120,014,089 L107Q probably damaging Het
Ctr9 C T 7: 111,053,446 R984C unknown Het
Cyp1b1 T C 17: 79,710,220 N502S probably benign Het
Cyp51 A T 5: 4,099,183 D231E probably damaging Het
Dscam T C 16: 96,622,715 T1677A possibly damaging Het
Dzip1 A C 14: 118,922,445 M117R possibly damaging Het
Ednrb G T 14: 103,821,674 S305R probably benign Het
Emilin1 A G 5: 30,917,165 D250G probably benign Het
Frrs1 A G 3: 116,885,129 N200S probably benign Het
Fstl5 T A 3: 76,429,738 probably benign Het
Gmcl1 A C 6: 86,726,177 S92A probably damaging Het
Gpr62 T C 9: 106,464,712 E339G probably benign Het
Hspd1 A T 1: 55,081,097 D315E probably damaging Het
Il19 A G 1: 130,935,957 V99A possibly damaging Het
Itga9 G A 9: 118,636,536 E153K probably damaging Het
Itgad T A 7: 128,204,560 V42E probably benign Het
Krt82 T C 15: 101,548,435 Y170C probably damaging Het
Map4k4 T A 1: 40,000,755 probably benign Het
Mdc1 T A 17: 35,849,010 V670D probably benign Het
Mfsd4b2 T A 10: 39,922,123 S79C probably benign Het
Mre11a A G 9: 14,826,547 E599G probably benign Het
Mthfsd G A 8: 121,105,773 T60I probably benign Het
Mycbp2 A T 14: 103,144,333 F3724I probably damaging Het
Nceh1 A G 3: 27,241,355 Y255C probably damaging Het
Ncoa2 C T 1: 13,186,889 V129I probably damaging Het
Ndufb5 T C 3: 32,746,451 F58L probably damaging Het
Npsr1 A G 9: 24,310,005 probably benign Het
Obscn C A 11: 59,030,018 probably null Het
Pdzd7 C G 19: 45,027,674 V1003L probably benign Het
Pias3 A G 3: 96,703,537 E377G possibly damaging Het
Pilra T A 5: 137,836,080 M14L probably benign Het
Pkhd1 T C 1: 20,058,302 Q4059R probably benign Het
Ppa2 A T 3: 133,321,003 probably null Het
Proser1 G A 3: 53,480,545 A885T probably benign Het
Robo2 A G 16: 73,961,888 I665T probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Secisbp2 G A 13: 51,654,635 probably null Het
Setbp1 T A 18: 78,923,996 Q171L probably benign Het
Spata1 A G 3: 146,487,540 L96P possibly damaging Het
Srprb G A 9: 103,198,839 Q800* probably null Het
Stk11ip A G 1: 75,529,267 probably benign Het
Tbl3 T C 17: 24,702,583 T445A probably damaging Het
Tdrd12 G A 7: 35,485,373 T705M probably damaging Het
Tek A G 4: 94,820,224 T340A probably benign Het
Timm22 G A 11: 76,414,099 A188T probably damaging Het
Tmeff1 T A 4: 48,604,692 probably null Het
Tmprss12 C A 15: 100,282,415 T112K possibly damaging Het
U2surp A G 9: 95,500,682 probably null Het
Vmn2r84 T A 10: 130,394,167 E25D probably benign Het
Wdr62 A T 7: 30,261,437 N22K possibly damaging Het
Wdr78 A G 4: 103,096,661 S114P probably benign Het
Zfp653 A T 9: 22,057,566 D426E probably benign Het
Zfyve28 G A 5: 34,196,662 P834L probably damaging Het
Zkscan16 A G 4: 58,957,364 T549A possibly damaging Het
Other mutations in Depdc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Depdc5 APN 5 32967814 splice site probably null
IGL01019:Depdc5 APN 5 32893401 missense probably damaging 0.96
IGL01067:Depdc5 APN 5 32899067 splice site probably null
IGL01405:Depdc5 APN 5 32937689 missense possibly damaging 0.90
IGL01577:Depdc5 APN 5 32955897 missense possibly damaging 0.49
IGL01633:Depdc5 APN 5 32924200 missense probably damaging 1.00
IGL01998:Depdc5 APN 5 32945151 splice site probably benign
IGL02025:Depdc5 APN 5 32946632 critical splice acceptor site probably null
IGL02167:Depdc5 APN 5 32903801 missense probably damaging 1.00
IGL02537:Depdc5 APN 5 32967787 missense probably damaging 1.00
IGL02812:Depdc5 APN 5 32893368 splice site probably benign
IGL03001:Depdc5 APN 5 32945090 missense possibly damaging 0.74
IGL03253:Depdc5 APN 5 32868813 unclassified probably benign
IGL02988:Depdc5 UTSW 5 32956167 splice site probably null
R0038:Depdc5 UTSW 5 32868853 missense probably benign 0.01
R0038:Depdc5 UTSW 5 32868853 missense probably benign 0.01
R0153:Depdc5 UTSW 5 32933937 splice site probably benign
R0179:Depdc5 UTSW 5 32901574 unclassified probably benign
R0212:Depdc5 UTSW 5 32912242 missense probably benign 0.00
R0239:Depdc5 UTSW 5 32943240 missense probably damaging 1.00
R0239:Depdc5 UTSW 5 32943240 missense probably damaging 1.00
R0302:Depdc5 UTSW 5 32904546 critical splice donor site probably benign
R0511:Depdc5 UTSW 5 32945028 nonsense probably null
R0677:Depdc5 UTSW 5 32901470 missense probably damaging 1.00
R0884:Depdc5 UTSW 5 32917978 missense possibly damaging 0.94
R0973:Depdc5 UTSW 5 32986966 missense possibly damaging 0.92
R1314:Depdc5 UTSW 5 32877074 missense probably damaging 1.00
R1611:Depdc5 UTSW 5 32990953 missense probably damaging 1.00
R1687:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R1748:Depdc5 UTSW 5 32917942 missense probably benign 0.24
R1903:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R1956:Depdc5 UTSW 5 32903831 missense probably damaging 1.00
R1997:Depdc5 UTSW 5 32901906 critical splice donor site probably null
R2079:Depdc5 UTSW 5 32946674 missense possibly damaging 0.75
R2131:Depdc5 UTSW 5 32990781 nonsense probably null
R2291:Depdc5 UTSW 5 32979402 missense probably damaging 1.00
R2422:Depdc5 UTSW 5 32991035 missense probably damaging 1.00
R2852:Depdc5 UTSW 5 32924171 missense probably damaging 0.96
R2937:Depdc5 UTSW 5 32901621 splice site probably null
R2938:Depdc5 UTSW 5 32901621 splice site probably null
R2974:Depdc5 UTSW 5 32934017 critical splice donor site probably null
R3884:Depdc5 UTSW 5 32944077 missense probably damaging 1.00
R3967:Depdc5 UTSW 5 32944115 nonsense probably null
R4118:Depdc5 UTSW 5 32964635 missense probably damaging 1.00
R4197:Depdc5 UTSW 5 32991203 missense possibly damaging 0.93
R4407:Depdc5 UTSW 5 32904534 critical splice donor site probably null
R4534:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R4535:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R4538:Depdc5 UTSW 5 32983946 missense probably damaging 1.00
R4613:Depdc5 UTSW 5 32975446 missense probably damaging 1.00
R4736:Depdc5 UTSW 5 32975322 missense probably benign
R4738:Depdc5 UTSW 5 32975322 missense probably benign
R4765:Depdc5 UTSW 5 32937635 missense probably damaging 1.00
R5021:Depdc5 UTSW 5 32979414 missense probably damaging 1.00
R5259:Depdc5 UTSW 5 32938291 missense probably damaging 1.00
R5261:Depdc5 UTSW 5 32938291 missense probably damaging 1.00
R5541:Depdc5 UTSW 5 32864629 utr 5 prime probably benign
R5594:Depdc5 UTSW 5 32901490 missense possibly damaging 0.46
R5929:Depdc5 UTSW 5 32975506 nonsense probably null
R6132:Depdc5 UTSW 5 32910467 missense probably damaging 0.99
R6146:Depdc5 UTSW 5 32968731 missense probably benign 0.01
R6336:Depdc5 UTSW 5 32964507 splice site probably null
R6468:Depdc5 UTSW 5 32912231 missense probably benign 0.02
R6911:Depdc5 UTSW 5 32924192 missense probably damaging 1.00
R6969:Depdc5 UTSW 5 32983860 missense probably damaging 1.00
R7002:Depdc5 UTSW 5 32877158 splice site probably null
R7066:Depdc5 UTSW 5 32901848 missense probably benign 0.08
R7231:Depdc5 UTSW 5 32901865 missense possibly damaging 0.92
R7264:Depdc5 UTSW 5 32967745 missense probably benign
R7302:Depdc5 UTSW 5 32979508 missense probably damaging 1.00
R7386:Depdc5 UTSW 5 32927936 missense probably benign
R7564:Depdc5 UTSW 5 32901510 missense probably damaging 1.00
R7636:Depdc5 UTSW 5 32917983 missense probably benign
R7795:Depdc5 UTSW 5 32944103 missense probably damaging 1.00
R7845:Depdc5 UTSW 5 32903915 splice site probably null
R8013:Depdc5 UTSW 5 32973842 missense probably benign 0.01
R8037:Depdc5 UTSW 5 32959348 critical splice donor site probably null
R8038:Depdc5 UTSW 5 32959348 critical splice donor site probably null
R8065:Depdc5 UTSW 5 32895908 missense possibly damaging 0.89
R8067:Depdc5 UTSW 5 32895908 missense possibly damaging 0.89
R8108:Depdc5 UTSW 5 32945049 missense probably benign 0.01
R8112:Depdc5 UTSW 5 32968706 missense possibly damaging 0.67
R8213:Depdc5 UTSW 5 32937637 missense probably damaging 1.00
R8382:Depdc5 UTSW 5 32927898 missense probably benign 0.00
R8680:Depdc5 UTSW 5 32944038 missense possibly damaging 0.48
R8743:Depdc5 UTSW 5 32924243 missense probably benign 0.10
R8754:Depdc5 UTSW 5 32979537 missense probably benign 0.00
X0027:Depdc5 UTSW 5 32904292 missense probably damaging 1.00
Z1176:Depdc5 UTSW 5 32943282 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GGGACAGGTCTTCAGAATACATG -3'
(R):5'- TACCTACAGGAAAAGTGTGCATC -3'

Sequencing Primer
(F):5'- TCGTTTCTCTTACTTGTGAG -3'
(R):5'- ATCCAGCGCCTTCTGTTGGAG -3'
Posted On2014-12-04