Incidental Mutation 'R0311:Abr'
ID25220
Institutional Source Beutler Lab
Gene Symbol Abr
Ensembl Gene ENSMUSG00000017631
Gene Nameactive BCR-related gene
Synonyms6330400K15Rik
MMRRC Submission 038521-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.477) question?
Stock #R0311 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location76416734-76622314 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76509127 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 15 (S15P)
Ref Sequence ENSEMBL: ENSMUSP00000091551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072740] [ENSMUST00000094012] [ENSMUST00000108407] [ENSMUST00000155035] [ENSMUST00000176024] [ENSMUST00000176179]
Predicted Effect probably benign
Transcript: ENSMUST00000072740
SMART Domains Protein: ENSMUSP00000072522
Gene: ENSMUSG00000017631

DomainStartEndE-ValueType
RhoGEF 95 283 2.37e-56 SMART
PH 302 461 1.58e-11 SMART
C2 505 612 1.88e-11 SMART
RhoGAP 658 837 6.57e-67 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000094012
AA Change: S15P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091551
Gene: ENSMUSG00000017631
AA Change: S15P

DomainStartEndE-ValueType
RhoGEF 107 295 2.37e-56 SMART
PH 314 473 1.58e-11 SMART
C2 517 624 1.88e-11 SMART
RhoGAP 670 849 6.57e-67 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108407
SMART Domains Protein: ENSMUSP00000104044
Gene: ENSMUSG00000017631

DomainStartEndE-ValueType
RhoGEF 49 237 2.37e-56 SMART
PH 256 415 1.58e-11 SMART
C2 459 566 1.88e-11 SMART
RhoGAP 612 791 6.57e-67 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119724
Predicted Effect probably benign
Transcript: ENSMUST00000155035
SMART Domains Protein: ENSMUSP00000122614
Gene: ENSMUSG00000017631

DomainStartEndE-ValueType
Pfam:RhoGEF 49 110 1.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176024
SMART Domains Protein: ENSMUSP00000135691
Gene: ENSMUSG00000017631

DomainStartEndE-ValueType
SCOP:d1kz7a1 41 92 1e-5 SMART
Blast:RhoGEF 49 92 5e-22 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000176179
SMART Domains Protein: ENSMUSP00000135515
Gene: ENSMUSG00000017631

DomainStartEndE-ValueType
Pfam:RhoGEF 49 128 1.1e-12 PFAM
Meta Mutation Damage Score 0.0727 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.6%
  • 20x: 91.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to the protein encoded by the breakpoint cluster region gene located on chromosome 22. The protein encoded by this gene contains a GTPase-activating protein domain, a domain found in members of the Rho family of GTP-binding proteins. Functional studies in mice determined that this protein plays a role in vestibular morphogenesis. Alternatively spliced transcript variants have been reported for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mutants are apparently normal, but double knockouts with Bcr show increased postnatal mortality, ataxia, hyperactivity, circling, lack of vestibular otoconia, ectopic cerebellar granule cells, and foliation defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A C 7: 120,402,904 M1547L probably damaging Het
Abcb4 A G 5: 8,934,243 K658E probably benign Het
Adgrb2 G C 4: 130,017,129 A1168P probably damaging Het
Adgre4 A T 17: 55,802,010 E339V probably benign Het
Asprv1 T C 6: 86,628,840 W223R probably damaging Het
Ccdc89 A G 7: 90,426,693 E37G probably damaging Het
Cd48 C A 1: 171,699,580 Y191* probably null Het
Chd4 T C 6: 125,101,665 I257T probably benign Het
Clca4b T C 3: 144,932,496 M2V probably benign Het
Dnah11 A T 12: 118,127,133 D1025E probably benign Het
Erich5 A G 15: 34,472,939 *363W probably null Het
Etl4 A G 2: 20,807,129 D1341G probably damaging Het
Fbxw11 A G 11: 32,722,083 T184A probably benign Het
Fktn A G 4: 53,744,620 Q300R probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gdpd3 G A 7: 126,767,189 R66Q possibly damaging Het
Hexb A G 13: 97,183,819 probably benign Het
Kdm4b A G 17: 56,386,200 R346G probably benign Het
Mbtd1 T A 11: 93,921,357 probably null Het
Med23 T A 10: 24,897,358 C653S possibly damaging Het
Nwd2 A T 5: 63,804,998 I642L probably damaging Het
Olfr1444 A G 19: 12,861,869 I31M probably benign Het
Olfr1448 T A 19: 12,920,096 Y71F possibly damaging Het
Olfr912 T C 9: 38,539,297 V134A probably benign Het
Pbld2 T C 10: 63,054,507 probably null Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plpp2 C T 10: 79,527,580 R77K probably damaging Het
Pym1 G T 10: 128,765,984 R168L possibly damaging Het
Rbm4 T C 19: 4,787,556 Y300C probably damaging Het
Rnf207 A G 4: 152,315,779 C175R probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Speg T C 1: 75,430,937 V3196A probably damaging Het
Syne1 T A 10: 5,348,943 I1048L possibly damaging Het
Th T C 7: 142,896,041 E41G probably damaging Het
Tmx4 T A 2: 134,598,526 *336L probably null Het
Tnfrsf18 T C 4: 156,026,415 V10A possibly damaging Het
Tnxb A T 17: 34,716,984 I2670F probably damaging Het
Tpx2 T C 2: 152,890,492 V562A probably damaging Het
Vmn2r73 A G 7: 85,871,789 S324P probably benign Het
Vps18 T C 2: 119,297,365 Y890H probably benign Het
Ythdc1 G A 5: 86,835,705 D670N probably damaging Het
Other mutations in Abr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Abr APN 11 76423089 missense probably damaging 0.96
IGL00571:Abr APN 11 76468740 missense probably benign 0.45
IGL01774:Abr APN 11 76464299 splice site probably benign
IGL02208:Abr APN 11 76455645 missense probably damaging 1.00
IGL02477:Abr APN 11 76461360 missense probably damaging 1.00
IGL02499:Abr APN 11 76509090 missense probably benign 0.39
IGL02606:Abr APN 11 76479164 missense probably damaging 1.00
IGL02955:Abr APN 11 76419165 missense probably damaging 1.00
IGL03136:Abr APN 11 76425295 nonsense probably null
R0051:Abr UTSW 11 76472502 missense probably benign 0.02
R0344:Abr UTSW 11 76479044 missense probably damaging 0.99
R0621:Abr UTSW 11 76509072 missense probably damaging 1.00
R0771:Abr UTSW 11 76455683 missense probably damaging 1.00
R1081:Abr UTSW 11 76455615 missense probably damaging 1.00
R1842:Abr UTSW 11 76508986 missense probably damaging 1.00
R2036:Abr UTSW 11 76452350 missense probably benign 0.08
R2147:Abr UTSW 11 76455648 missense probably damaging 1.00
R2250:Abr UTSW 11 76451939 missense probably damaging 1.00
R3153:Abr UTSW 11 76486469 missense probably damaging 1.00
R3928:Abr UTSW 11 76468735 missense probably benign 0.01
R4507:Abr UTSW 11 76451857 missense possibly damaging 0.65
R4518:Abr UTSW 11 76472518 missense possibly damaging 0.72
R4632:Abr UTSW 11 76509019 missense probably benign 0.10
R4751:Abr UTSW 11 76456608 missense possibly damaging 0.79
R4853:Abr UTSW 11 76464261 missense probably damaging 1.00
R5255:Abr UTSW 11 76455683 missense probably damaging 1.00
R5693:Abr UTSW 11 76463577 missense probably damaging 1.00
R6459:Abr UTSW 11 76424989 missense probably damaging 0.98
R6478:Abr UTSW 11 76452332 missense probably damaging 0.99
R7030:Abr UTSW 11 76459212 missense probably damaging 1.00
R7221:Abr UTSW 11 76423161 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GCCAAATGACAGGCGTCACAAG -3'
(R):5'- ACATGCTATTAGGCGGGTGGAGAC -3'

Sequencing Primer
(F):5'- AGCTCACTGCTGACACTG -3'
(R):5'- GGAGACAGCAGAACCGCTC -3'
Posted On2013-04-16