Mutagenetix > Incidental Mutation

Incidental Mutation 'R0311:Abr'

25220

Institutional Source

Beutler Lab

Gene Symbol

Abr

Ensembl Gene

ENSMUSG00000017631

Gene Name

active BCR-related gene

Synonyms

6330400K15Rik

MMRRC Submission

038521-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.702) question?

Stock #

R0311 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

76416734-76622314 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 76509127 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 15 (S15P)

Ref Sequence

ENSEMBL: ENSMUSP00000091551 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072740] [ENSMUST00000094012] [ENSMUST00000108407] [ENSMUST00000155035] [ENSMUST00000176024] [ENSMUST00000176179]

AlphaFold

Q5SSL4

Predicted Effect

probably benign
Transcript: ENSMUST00000072740

SMART Domains

Protein: ENSMUSP00000072522
Gene: ENSMUSG00000017631

Domain	Start	End	E-Value	Type
RhoGEF	95	283	2.37e-56	SMART
PH	302	461	1.58e-11	SMART
C2	505	612	1.88e-11	SMART
RhoGAP	658	837	6.57e-67	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000094012
AA Change: S15P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000091551
Gene: ENSMUSG00000017631
AA Change: S15P

Domain	Start	End	E-Value	Type
RhoGEF	107	295	2.37e-56	SMART
PH	314	473	1.58e-11	SMART
C2	517	624	1.88e-11	SMART
RhoGAP	670	849	6.57e-67	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000108407

SMART Domains

Protein: ENSMUSP00000104044
Gene: ENSMUSG00000017631

Domain	Start	End	E-Value	Type
RhoGEF	49	237	2.37e-56	SMART
PH	256	415	1.58e-11	SMART
C2	459	566	1.88e-11	SMART
RhoGAP	612	791	6.57e-67	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000119724

Predicted Effect

probably benign
Transcript: ENSMUST00000155035

SMART Domains

Protein: ENSMUSP00000122614
Gene: ENSMUSG00000017631

Domain	Start	End	E-Value	Type
Pfam:RhoGEF	49	110	1.6e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000176024

SMART Domains

Protein: ENSMUSP00000135691
Gene: ENSMUSG00000017631

Domain	Start	End	E-Value	Type
SCOP:d1kz7a1	41	92	1e-5	SMART
Blast:RhoGEF	49	92	5e-22	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000176179

SMART Domains

Protein: ENSMUSP00000135515
Gene: ENSMUSG00000017631

Domain	Start	End	E-Value	Type
Pfam:RhoGEF	49	128	1.1e-12	PFAM

Meta Mutation Damage Score

0.0727

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.6%
20x: 91.6%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to the protein encoded by the breakpoint cluster region gene located on chromosome 22. The protein encoded by this gene contains a GTPase-activating protein domain, a domain found in members of the Rho family of GTP-binding proteins. Functional studies in mice determined that this protein plays a role in vestibular morphogenesis. Alternatively spliced transcript variants have been reported for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mutants are apparently normal, but double knockouts with Bcr show increased postnatal mortality, ataxia, hyperactivity, circling, lack of vestibular otoconia, ectopic cerebellar granule cells, and foliation defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	A	C	7: 120,402,904	M1547L	probably damaging	Het
Abcb4	A	G	5: 8,934,243	K658E	probably benign	Het
Adgrb2	G	C	4: 130,017,129	A1168P	probably damaging	Het
Adgre4	A	T	17: 55,802,010	E339V	probably benign	Het
Asprv1	T	C	6: 86,628,840	W223R	probably damaging	Het
Ccdc89	A	G	7: 90,426,693	E37G	probably damaging	Het
Cd48	C	A	1: 171,699,580	Y191*	probably null	Het
Chd4	T	C	6: 125,101,665	I257T	probably benign	Het
Clca4b	T	C	3: 144,932,496	M2V	probably benign	Het
Dnah11	A	T	12: 118,127,133	D1025E	probably benign	Het
Erich5	A	G	15: 34,472,939	*363W	probably null	Het
Etl4	A	G	2: 20,807,129	D1341G	probably damaging	Het
Fbxw11	A	G	11: 32,722,083	T184A	probably benign	Het
Fktn	A	G	4: 53,744,620	Q300R	probably benign	Het
G3bp1	T	C	11: 55,498,626	F383L	probably damaging	Het
Gdpd3	G	A	7: 126,767,189	R66Q	possibly damaging	Het
Hexb	A	G	13: 97,183,819		probably benign	Het
Kdm4b	A	G	17: 56,386,200	R346G	probably benign	Het
Mbtd1	T	A	11: 93,921,357		probably null	Het
Med23	T	A	10: 24,897,358	C653S	possibly damaging	Het
Nwd2	A	T	5: 63,804,998	I642L	probably damaging	Het
Olfr1444	A	G	19: 12,861,869	I31M	probably benign	Het
Olfr1448	T	A	19: 12,920,096	Y71F	possibly damaging	Het
Olfr912	T	C	9: 38,539,297	V134A	probably benign	Het
Pbld2	T	C	10: 63,054,507		probably null	Het
Pkd1l3	G	A	8: 109,623,663	S380N	probably benign	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Plpp2	C	T	10: 79,527,580	R77K	probably damaging	Het
Pym1	G	T	10: 128,765,984	R168L	possibly damaging	Het
Rbm4	T	C	19: 4,787,556	Y300C	probably damaging	Het
Rnf207	A	G	4: 152,315,779	C175R	probably damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Speg	T	C	1: 75,430,937	V3196A	probably damaging	Het
Syne1	T	A	10: 5,348,943	I1048L	possibly damaging	Het
Th	T	C	7: 142,896,041	E41G	probably damaging	Het
Tmx4	T	A	2: 134,598,526	*336L	probably null	Het
Tnfrsf18	T	C	4: 156,026,415	V10A	possibly damaging	Het
Tnxb	A	T	17: 34,716,984	I2670F	probably damaging	Het
Tpx2	T	C	2: 152,890,492	V562A	probably damaging	Het
Vmn2r73	A	G	7: 85,871,789	S324P	probably benign	Het
Vps18	T	C	2: 119,297,365	Y890H	probably benign	Het
Ythdc1	G	A	5: 86,835,705	D670N	probably damaging	Het

Other mutations in Abr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Abr	APN	11	76423089	missense	probably damaging	0.96
IGL00571:Abr	APN	11	76468740	missense	probably benign	0.45
IGL01774:Abr	APN	11	76464299	splice site	probably benign
IGL02208:Abr	APN	11	76455645	missense	probably damaging	1.00
IGL02477:Abr	APN	11	76461360	missense	probably damaging	1.00
IGL02499:Abr	APN	11	76509090	missense	probably benign	0.39
IGL02606:Abr	APN	11	76479164	missense	probably damaging	1.00
IGL02955:Abr	APN	11	76419165	missense	probably damaging	1.00
IGL03136:Abr	APN	11	76425295	nonsense	probably null
R0051:Abr	UTSW	11	76472502	missense	probably benign	0.02
R0344:Abr	UTSW	11	76479044	missense	probably damaging	0.99
R0621:Abr	UTSW	11	76509072	missense	probably damaging	1.00
R0771:Abr	UTSW	11	76455683	missense	probably damaging	1.00
R1081:Abr	UTSW	11	76455615	missense	probably damaging	1.00
R1842:Abr	UTSW	11	76508986	missense	probably damaging	1.00
R2036:Abr	UTSW	11	76452350	missense	probably benign	0.08
R2147:Abr	UTSW	11	76455648	missense	probably damaging	1.00
R2250:Abr	UTSW	11	76451939	missense	probably damaging	1.00
R3153:Abr	UTSW	11	76486469	missense	probably damaging	1.00
R3928:Abr	UTSW	11	76468735	missense	probably benign	0.01
R4507:Abr	UTSW	11	76451857	missense	possibly damaging	0.65
R4518:Abr	UTSW	11	76472518	missense	possibly damaging	0.72
R4632:Abr	UTSW	11	76509019	missense	probably benign	0.10
R4751:Abr	UTSW	11	76456608	missense	possibly damaging	0.79
R4853:Abr	UTSW	11	76464261	missense	probably damaging	1.00
R5255:Abr	UTSW	11	76455683	missense	probably damaging	1.00
R5693:Abr	UTSW	11	76463577	missense	probably damaging	1.00
R6459:Abr	UTSW	11	76424989	missense	probably damaging	0.98
R6478:Abr	UTSW	11	76452332	missense	probably damaging	0.99
R7030:Abr	UTSW	11	76459212	missense	probably damaging	1.00
R7221:Abr	UTSW	11	76423161	missense	probably benign	0.09
R8353:Abr	UTSW	11	76419833	missense	probably damaging	1.00
R8362:Abr	UTSW	11	76479128	missense	probably benign	0.00
R8962:Abr	UTSW	11	76461329	missense	probably damaging	1.00
R8967:Abr	UTSW	11	76479029	missense	possibly damaging	0.52
R9130:Abr	UTSW	11	76451927	missense	possibly damaging	0.91
R9275:Abr	UTSW	11	76464282	missense	probably damaging	1.00
R9492:Abr	UTSW	11	76508925	missense	probably benign
R9516:Abr	UTSW	11	76419832	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCAAATGACAGGCGTCACAAG -3'
(R):5'- ACATGCTATTAGGCGGGTGGAGAC -3'

Sequencing Primer
(F):5'- AGCTCACTGCTGACACTG -3'
(R):5'- GGAGACAGCAGAACCGCTC -3'

Posted On

2013-04-16