Incidental Mutation 'R2504:Eml5'
ID 252208
Institutional Source Beutler Lab
Gene Symbol Eml5
Ensembl Gene ENSMUSG00000051166
Gene Name echinoderm microtubule associated protein like 5
Synonyms C130068M19Rik
MMRRC Submission 040412-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.225) question?
Stock # R2504 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 98786805-98901484 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 98844105 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 864 (D864G)
Ref Sequence ENSEMBL: ENSMUSP00000152709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]
AlphaFold Q8BQM8
Predicted Effect probably benign
Transcript: ENSMUST00000065716
AA Change: D825G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: D825G

DomainStartEndE-ValueType
Pfam:HELP 1 49 3.3e-21 PFAM
WD40 50 91 6.42e-1 SMART
WD40 94 136 1.08e-4 SMART
WD40 139 178 1.27e-1 SMART
WD40 184 224 2.75e1 SMART
WD40 225 263 2.65e-4 SMART
Blast:WD40 265 312 2e-22 BLAST
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.2e2 SMART
WD40 397 436 8.59e-1 SMART
WD40 444 479 6.6e1 SMART
WD40 505 546 2.74e2 SMART
WD40 552 592 4.8e-2 SMART
low complexity region 609 632 N/A INTRINSIC
Pfam:HELP 656 715 1.4e-20 PFAM
WD40 716 757 1.18e-1 SMART
WD40 760 802 2.84e-4 SMART
WD40 805 844 1.91e1 SMART
WD40 853 891 2.64e2 SMART
WD40 892 929 3.45e-3 SMART
WD40 985 1026 4.55e-3 SMART
WD40 1029 1068 6.39e0 SMART
WD40 1071 1111 5.15e-2 SMART
WD40 1180 1221 1.9e2 SMART
WD40 1227 1267 1.38e0 SMART
low complexity region 1280 1297 N/A INTRINSIC
Pfam:HELP 1335 1410 2.4e-16 PFAM
Blast:WD40 1412 1462 8e-28 BLAST
WD40 1465 1507 1.56e-1 SMART
WD40 1510 1549 2.06e0 SMART
WD40 1558 1597 8.22e1 SMART
WD40 1599 1644 4.26e1 SMART
WD40 1690 1730 2.19e-5 SMART
WD40 1774 1813 5.97e-1 SMART
WD40 1884 1925 2.39e0 SMART
WD40 1931 1971 2.88e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000223282
AA Change: D864G

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,219,216 E1750K probably damaging Het
4933425L06Rik A G 13: 105,109,742 I270M probably benign Het
Aatk T C 11: 120,018,855 D28G probably benign Het
Abcg1 T A 17: 31,092,395 S125T probably damaging Het
Actbl2 T C 13: 111,256,183 S351P possibly damaging Het
Ankrd34b A G 13: 92,439,061 probably null Het
BC030867 T C 11: 102,255,296 Y133H possibly damaging Het
BC051665 C T 13: 60,782,654 V295I probably benign Het
C1qtnf2 A G 11: 43,491,156 N265S probably damaging Het
Ccdc14 C T 16: 34,721,850 R573* probably null Het
Cd55b A T 1: 130,409,875 Y247N probably damaging Het
Celsr2 A T 3: 108,413,591 V635E probably benign Het
Clec16a T C 16: 10,559,687 probably benign Het
Clec4b1 A G 6: 123,065,945 Y41C probably damaging Het
Cntn5 A T 9: 10,172,121 D19E probably benign Het
Cop1 A G 1: 159,232,805 N53S probably damaging Het
Csad A T 15: 102,188,667 M1K probably null Het
Cyb5rl A G 4: 107,080,945 I200V probably benign Het
Cyp26a1 A G 19: 37,698,342 T81A probably damaging Het
Cyp2d12 A T 15: 82,559,036 H433L probably benign Het
D7Ertd443e T A 7: 134,349,479 probably null Het
Dennd1b A G 1: 139,170,170 probably benign Het
Dmap1 G T 4: 117,675,298 T357K probably damaging Het
Dzip1 G T 14: 118,881,044 T759K probably benign Het
Elmo2 A G 2: 165,298,687 V300A probably damaging Het
Ep400 A G 5: 110,668,645 V2670A probably damaging Het
Epha3 T A 16: 63,603,625 I534F probably damaging Het
Epha4 A C 1: 77,382,991 Y742D probably damaging Het
Ergic2 A G 6: 148,204,774 probably null Het
Ero1l A T 14: 45,299,088 probably null Het
Fam229a A G 4: 129,491,486 D70G probably damaging Het
Fbn2 C T 18: 58,093,359 R781Q probably damaging Het
Fbxo16 A T 14: 65,270,714 probably benign Het
Fbxo39 T A 11: 72,317,285 S154R probably benign Het
Fer T A 17: 63,991,580 probably null Het
Filip1l A T 16: 57,571,047 D428V probably damaging Het
Filip1l A G 16: 57,570,662 I538V possibly damaging Het
Fsip2 T C 2: 82,979,610 I2091T possibly damaging Het
Glyat A C 19: 12,651,398 T186P possibly damaging Het
Gm10604 A G 4: 11,980,083 S74P unknown Het
Gm4787 T G 12: 81,379,137 K82N possibly damaging Het
Hectd4 T C 5: 121,220,620 I50T unknown Het
Hectd4 T C 5: 121,263,967 S373P possibly damaging Het
Hmcn1 A T 1: 150,686,867 C2313* probably null Het
Igfn1 A T 1: 135,969,316 S1171T probably benign Het
Ints8 T C 4: 11,241,642 D267G probably benign Het
Itln1 A G 1: 171,529,159 C251R probably damaging Het
Jcad C T 18: 4,674,026 T596M probably damaging Het
Kcnj16 C T 11: 111,025,583 T357M probably benign Het
Kif13a G A 13: 46,814,200 T346M probably damaging Het
Klhl24 G A 16: 20,120,167 A491T probably benign Het
Kntc1 C T 5: 123,778,347 Q748* probably null Het
Krt25 T A 11: 99,317,296 K369* probably null Het
Krt75 C T 15: 101,568,031 R433Q probably benign Het
Krt76 A G 15: 101,884,858 F582L unknown Het
Lysmd1 G A 3: 95,138,397 V182I probably benign Het
Mab21l2 T A 3: 86,547,555 E46V probably damaging Het
Magi2 A T 5: 20,358,936 K355N probably damaging Het
March10 T C 11: 105,385,572 D630G probably damaging Het
Mast4 A T 13: 102,738,639 I1215N probably damaging Het
Nckap1 G A 2: 80,530,218 T523I probably benign Het
Nexmif T A X: 104,084,393 D1306V probably damaging Het
Nfkb1 A C 3: 135,589,329 I918R possibly damaging Het
Nup50 A T 15: 84,933,658 T93S probably benign Het
Nwd2 T C 5: 63,804,374 Y434H probably benign Het
Olfr61 T C 7: 140,638,484 V261A probably benign Het
Osbpl1a C A 18: 12,905,031 V288L probably benign Het
Pan3 A G 5: 147,527,036 E562G possibly damaging Het
Pappa T A 4: 65,180,889 Y548* probably null Het
Phf3 A T 1: 30,810,789 L1181Q probably damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Pkhd1l1 T C 15: 44,485,428 I240T probably damaging Het
Pole G A 5: 110,290,502 probably null Het
Polq T A 16: 37,011,942 S15T unknown Het
Prrt2 T C 7: 127,020,224 E23G possibly damaging Het
Prss37 A T 6: 40,517,826 probably null Het
Prune2 T C 19: 17,000,036 L45P probably damaging Het
Psd A T 19: 46,324,913 M6K possibly damaging Het
Psmd1 A G 1: 86,089,997 E510G possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Pxdn T A 12: 30,003,406 I1194N probably damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rgmb C A 17: 15,807,647 R270L probably benign Het
Rpgrip1l A G 8: 91,280,716 probably null Het
Rps2 G A 17: 24,720,379 probably benign Het
Rsbn1l G T 5: 20,902,366 A550E probably damaging Het
S1pr4 C T 10: 81,499,304 R112H probably benign Het
Scfd2 T C 5: 74,531,177 N148S probably damaging Het
Scin C T 12: 40,081,706 M276I probably benign Het
Sec24d T C 3: 123,353,606 I708T possibly damaging Het
Skint11 T A 4: 114,228,812 F41I possibly damaging Het
Slc15a4 A T 5: 127,617,239 F44Y possibly damaging Het
Slc6a18 A G 13: 73,675,806 Y72H probably benign Het
Slc7a11 A T 3: 50,377,746 probably null Het
Slc7a14 G T 3: 31,237,501 N209K possibly damaging Het
Sstr2 T C 11: 113,624,431 C59R probably damaging Het
Stab1 A G 14: 31,163,040 probably null Het
Stag1 G T 9: 100,866,210 S475I probably damaging Het
Stxbp5l A G 16: 37,115,667 Y1183H probably damaging Het
Svep1 A T 4: 58,135,628 probably null Het
Tm9sf2 A G 14: 122,158,684 T653A probably benign Het
Tmeff1 T C 4: 48,662,059 S366P possibly damaging Het
Tnnt2 G T 1: 135,852,065 W300L probably damaging Het
Traj32 A G 14: 54,186,103 probably benign Het
Trp53bp2 A T 1: 182,441,639 M223L probably benign Het
Tsga10 G A 1: 37,815,677 T246M probably damaging Het
Txn2 A T 15: 77,926,670 probably benign Het
Ubr3 T A 2: 69,938,198 F450I probably damaging Het
Usp47 T C 7: 112,104,470 probably null Het
Vars2 C T 17: 35,664,793 R244Q probably damaging Het
Xrra1 T A 7: 99,897,596 F251L probably damaging Het
Zfp804a G A 2: 82,257,519 R564Q probably benign Het
Zfp983 T C 17: 21,658,967 C29R probably damaging Het
Other mutations in Eml5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Eml5 APN 12 98873209 splice site probably benign
IGL00473:Eml5 APN 12 98805492 splice site probably benign
IGL01120:Eml5 APN 12 98844019 missense probably benign
IGL01308:Eml5 APN 12 98802313 missense probably damaging 1.00
IGL01790:Eml5 APN 12 98798932 missense probably damaging 1.00
IGL01973:Eml5 APN 12 98863280 missense probably benign
IGL02182:Eml5 APN 12 98802322 missense probably damaging 1.00
IGL02201:Eml5 APN 12 98794424 splice site probably benign
IGL02375:Eml5 APN 12 98844087 missense probably damaging 1.00
IGL02397:Eml5 APN 12 98790674 missense probably benign 0.07
IGL02480:Eml5 APN 12 98876243 missense probably damaging 1.00
IGL02801:Eml5 APN 12 98817845 missense possibly damaging 0.88
IGL02876:Eml5 APN 12 98858841 missense probably damaging 1.00
IGL03104:Eml5 APN 12 98861245 nonsense probably null
IGL03158:Eml5 APN 12 98827514 splice site probably benign
IGL03286:Eml5 APN 12 98860503 missense probably damaging 1.00
IGL03380:Eml5 APN 12 98874647 splice site probably benign
BB010:Eml5 UTSW 12 98844020 missense possibly damaging 0.87
BB020:Eml5 UTSW 12 98844020 missense possibly damaging 0.87
R0573:Eml5 UTSW 12 98824772 splice site probably null
R0624:Eml5 UTSW 12 98865479 missense probably damaging 1.00
R0993:Eml5 UTSW 12 98861183 missense probably benign 0.25
R1073:Eml5 UTSW 12 98830973 missense probably damaging 1.00
R1183:Eml5 UTSW 12 98792046 missense probably benign 0.31
R1352:Eml5 UTSW 12 98831003 splice site probably benign
R1469:Eml5 UTSW 12 98858823 missense probably benign
R1469:Eml5 UTSW 12 98858823 missense probably benign
R1503:Eml5 UTSW 12 98831174 missense probably damaging 0.99
R1538:Eml5 UTSW 12 98794276 missense probably damaging 0.99
R1689:Eml5 UTSW 12 98830935 missense probably damaging 1.00
R1773:Eml5 UTSW 12 98798839 missense probably damaging 1.00
R1775:Eml5 UTSW 12 98852704 splice site probably null
R1791:Eml5 UTSW 12 98887056 missense probably benign 0.31
R1856:Eml5 UTSW 12 98810584 missense probably damaging 1.00
R1919:Eml5 UTSW 12 98798839 missense probably damaging 1.00
R1957:Eml5 UTSW 12 98859961 missense probably damaging 1.00
R1962:Eml5 UTSW 12 98876311 missense probably damaging 0.99
R2033:Eml5 UTSW 12 98791386 missense possibly damaging 0.71
R2035:Eml5 UTSW 12 98794266 missense probably benign 0.33
R2073:Eml5 UTSW 12 98802446 missense probably damaging 0.99
R2143:Eml5 UTSW 12 98810605 missense probably damaging 1.00
R2144:Eml5 UTSW 12 98810605 missense probably damaging 1.00
R2158:Eml5 UTSW 12 98843946 splice site probably benign
R2164:Eml5 UTSW 12 98887097 missense probably damaging 0.99
R2175:Eml5 UTSW 12 98876223 nonsense probably null
R2200:Eml5 UTSW 12 98825417 missense probably damaging 1.00
R2234:Eml5 UTSW 12 98841581 missense probably damaging 1.00
R2871:Eml5 UTSW 12 98865401 missense probably damaging 1.00
R2871:Eml5 UTSW 12 98865401 missense probably damaging 1.00
R2958:Eml5 UTSW 12 98876178 missense possibly damaging 0.74
R3013:Eml5 UTSW 12 98880808 splice site probably null
R3118:Eml5 UTSW 12 98865494 missense probably damaging 0.97
R3735:Eml5 UTSW 12 98855989 missense possibly damaging 0.78
R3856:Eml5 UTSW 12 98816024 missense probably damaging 1.00
R3900:Eml5 UTSW 12 98825523 missense probably damaging 1.00
R3973:Eml5 UTSW 12 98802465 splice site probably benign
R3976:Eml5 UTSW 12 98802465 splice site probably benign
R4105:Eml5 UTSW 12 98841548 splice site probably null
R4107:Eml5 UTSW 12 98841548 splice site probably null
R4108:Eml5 UTSW 12 98841548 splice site probably null
R4109:Eml5 UTSW 12 98841548 splice site probably null
R4258:Eml5 UTSW 12 98865434 missense probably benign 0.01
R4381:Eml5 UTSW 12 98815955 missense possibly damaging 0.93
R4590:Eml5 UTSW 12 98837341 missense possibly damaging 0.91
R4737:Eml5 UTSW 12 98798852 missense probably damaging 1.00
R4775:Eml5 UTSW 12 98802307 missense probably benign 0.05
R4850:Eml5 UTSW 12 98790619 missense probably damaging 1.00
R5007:Eml5 UTSW 12 98830965 missense probably damaging 1.00
R5092:Eml5 UTSW 12 98792616 missense probably damaging 1.00
R5123:Eml5 UTSW 12 98874512 missense probably damaging 1.00
R5124:Eml5 UTSW 12 98792042 missense probably damaging 1.00
R5273:Eml5 UTSW 12 98790688 missense probably damaging 1.00
R5369:Eml5 UTSW 12 98858783 missense probably damaging 1.00
R5430:Eml5 UTSW 12 98794158 missense probably damaging 1.00
R5748:Eml5 UTSW 12 98825555 missense probably damaging 0.99
R5769:Eml5 UTSW 12 98790619 missense probably damaging 1.00
R5832:Eml5 UTSW 12 98876188 missense probably benign
R6113:Eml5 UTSW 12 98824674 nonsense probably null
R6131:Eml5 UTSW 12 98861251 missense probably damaging 0.99
R6175:Eml5 UTSW 12 98794456 missense possibly damaging 0.69
R6184:Eml5 UTSW 12 98863129 missense possibly damaging 0.53
R6357:Eml5 UTSW 12 98870884 missense probably damaging 0.98
R6375:Eml5 UTSW 12 98798868
R6528:Eml5 UTSW 12 98824637 missense probably benign 0.18
R6657:Eml5 UTSW 12 98791405 missense probably damaging 0.98
R6717:Eml5 UTSW 12 98827506 missense probably damaging 1.00
R6751:Eml5 UTSW 12 98865400 missense probably damaging 1.00
R6833:Eml5 UTSW 12 98887024 missense probably damaging 1.00
R6834:Eml5 UTSW 12 98887024 missense probably damaging 1.00
R6972:Eml5 UTSW 12 98876180 missense probably benign 0.00
R7091:Eml5 UTSW 12 98802474 missense probably benign 0.16
R7353:Eml5 UTSW 12 98825424 missense
R7644:Eml5 UTSW 12 98855944 missense probably benign 0.05
R7694:Eml5 UTSW 12 98792563 missense probably damaging 0.99
R7842:Eml5 UTSW 12 98794135 missense probably damaging 1.00
R7933:Eml5 UTSW 12 98844020 missense possibly damaging 0.87
R8111:Eml5 UTSW 12 98792514 critical splice donor site probably null
R8198:Eml5 UTSW 12 98858886 nonsense probably null
R8482:Eml5 UTSW 12 98876301 missense probably damaging 1.00
R8732:Eml5 UTSW 12 98815959 missense probably damaging 0.99
R8956:Eml5 UTSW 12 98852693 missense possibly damaging 0.69
R8975:Eml5 UTSW 12 98810570 missense probably damaging 0.99
R9131:Eml5 UTSW 12 98858840 missense probably damaging 1.00
R9258:Eml5 UTSW 12 98844117 missense possibly damaging 0.77
R9261:Eml5 UTSW 12 98856028 missense probably damaging 0.99
R9276:Eml5 UTSW 12 98798801 missense probably damaging 0.99
R9301:Eml5 UTSW 12 98882033 nonsense probably null
R9368:Eml5 UTSW 12 98796578 missense probably benign 0.31
R9392:Eml5 UTSW 12 98900940 missense probably damaging 1.00
R9393:Eml5 UTSW 12 98876174 missense probably benign 0.35
R9449:Eml5 UTSW 12 98861295 missense probably damaging 1.00
R9570:Eml5 UTSW 12 98815984 missense probably benign 0.15
T0722:Eml5 UTSW 12 98841582 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGCTCCCTCCATGATAG -3'
(R):5'- AGGCTGTCAATGTGAGCCTG -3'

Sequencing Primer
(F):5'- ATGCATACTGAACACGGG -3'
(R):5'- CTGTCAATGTGAGCCTGTATTGATC -3'
Posted On 2014-12-04