Incidental Mutation 'R2851:Crispld2'
ID252211
Institutional Source Beutler Lab
Gene Symbol Crispld2
Ensembl Gene ENSMUSG00000031825
Gene Namecysteine-rich secretory protein LCCL domain containing 2
Synonyms1810049K24Rik, Lgl1, coffeecrisp
MMRRC Submission 040444-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2851 (G1)
Quality Score221
Status Validated
Chromosome8
Chromosomal Location119992438-120052793 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120014089 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 107 (L107Q)
Ref Sequence ENSEMBL: ENSMUSP00000122962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034282] [ENSMUST00000108972] [ENSMUST00000127664] [ENSMUST00000132583]
Predicted Effect probably damaging
Transcript: ENSMUST00000034282
AA Change: L107Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034282
Gene: ENSMUSG00000031825
AA Change: L107Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SCP 54 208 1.2e-48 SMART
LCCL 284 368 1.25e-45 SMART
LCCL 385 477 1.28e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108972
AA Change: L107Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104600
Gene: ENSMUSG00000031825
AA Change: L107Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SCP 54 208 1.2e-48 SMART
LCCL 283 367 1.25e-45 SMART
LCCL 384 476 1.28e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000132583
AA Change: L107Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000122962
Gene: ENSMUSG00000031825
AA Change: L107Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SCP 54 208 1.2e-48 SMART
LCCL 283 367 1.25e-45 SMART
LCCL 384 476 1.28e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151629
Meta Mutation Damage Score 0.3955 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (61/62)
MGI Phenotype PHENOTYPE: Homozygous mutant mice show various immunological abnormalities, enhanced glucose tolerance and decreased bone-related measurements. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2cl T C 9: 110,894,135 S636P probably damaging Het
Arhgef4 A C 1: 34,724,048 D795A unknown Het
Bank1 A T 3: 136,242,940 S159T possibly damaging Het
Catsperd A G 17: 56,660,169 probably null Het
Ccdc85a A G 11: 28,392,942 probably benign Het
Ceacam11 T C 7: 17,978,526 I300T probably benign Het
Cmtm5 A G 14: 54,938,055 probably benign Het
Cnn3 C T 3: 121,450,053 probably benign Het
Col12a1 A T 9: 79,678,332 N1254K probably damaging Het
Ctr9 C T 7: 111,053,446 R984C unknown Het
Cyp1b1 T C 17: 79,710,220 N502S probably benign Het
Cyp51 A T 5: 4,099,183 D231E probably damaging Het
Depdc5 A G 5: 32,924,171 E559G probably damaging Het
Dscam T C 16: 96,622,715 T1677A possibly damaging Het
Dzip1 A C 14: 118,922,445 M117R possibly damaging Het
Ednrb G T 14: 103,821,674 S305R probably benign Het
Emilin1 A G 5: 30,917,165 D250G probably benign Het
Frrs1 A G 3: 116,885,129 N200S probably benign Het
Fstl5 T A 3: 76,429,738 probably benign Het
Gmcl1 A C 6: 86,726,177 S92A probably damaging Het
Gpr62 T C 9: 106,464,712 E339G probably benign Het
Hspd1 A T 1: 55,081,097 D315E probably damaging Het
Il19 A G 1: 130,935,957 V99A possibly damaging Het
Itga9 G A 9: 118,636,536 E153K probably damaging Het
Itgad T A 7: 128,204,560 V42E probably benign Het
Krt82 T C 15: 101,548,435 Y170C probably damaging Het
Map4k4 T A 1: 40,000,755 probably benign Het
Mdc1 T A 17: 35,849,010 V670D probably benign Het
Mfsd4b2 T A 10: 39,922,123 S79C probably benign Het
Mre11a A G 9: 14,826,547 E599G probably benign Het
Mthfsd G A 8: 121,105,773 T60I probably benign Het
Mycbp2 A T 14: 103,144,333 F3724I probably damaging Het
Nceh1 A G 3: 27,241,355 Y255C probably damaging Het
Ncoa2 C T 1: 13,186,889 V129I probably damaging Het
Ndufb5 T C 3: 32,746,451 F58L probably damaging Het
Npsr1 A G 9: 24,310,005 probably benign Het
Obscn C A 11: 59,030,018 probably null Het
Pdzd7 C G 19: 45,027,674 V1003L probably benign Het
Pias3 A G 3: 96,703,537 E377G possibly damaging Het
Pilra T A 5: 137,836,080 M14L probably benign Het
Pkhd1 T C 1: 20,058,302 Q4059R probably benign Het
Ppa2 A T 3: 133,321,003 probably null Het
Proser1 G A 3: 53,480,545 A885T probably benign Het
Robo2 A G 16: 73,961,888 I665T probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Secisbp2 G A 13: 51,654,635 probably null Het
Setbp1 T A 18: 78,923,996 Q171L probably benign Het
Spata1 A G 3: 146,487,540 L96P possibly damaging Het
Srprb G A 9: 103,198,839 Q800* probably null Het
Stk11ip A G 1: 75,529,267 probably benign Het
Tbl3 T C 17: 24,702,583 T445A probably damaging Het
Tdrd12 G A 7: 35,485,373 T705M probably damaging Het
Tek A G 4: 94,820,224 T340A probably benign Het
Timm22 G A 11: 76,414,099 A188T probably damaging Het
Tmeff1 T A 4: 48,604,692 probably null Het
Tmprss12 C A 15: 100,282,415 T112K possibly damaging Het
U2surp A G 9: 95,500,682 probably null Het
Vmn2r84 T A 10: 130,394,167 E25D probably benign Het
Wdr62 A T 7: 30,261,437 N22K possibly damaging Het
Wdr78 A G 4: 103,096,661 S114P probably benign Het
Zfp653 A T 9: 22,057,566 D426E probably benign Het
Zfyve28 G A 5: 34,196,662 P834L probably damaging Het
Zkscan16 A G 4: 58,957,364 T549A possibly damaging Het
Other mutations in Crispld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Crispld2 APN 8 120033560 missense probably damaging 1.00
IGL00835:Crispld2 APN 8 120010648 missense probably damaging 1.00
IGL03209:Crispld2 APN 8 120031098 missense possibly damaging 0.88
IGL03324:Crispld2 APN 8 120015371 missense probably damaging 1.00
R0172:Crispld2 UTSW 8 120026071 missense possibly damaging 0.80
R0212:Crispld2 UTSW 8 120010631 missense probably benign
R0492:Crispld2 UTSW 8 120026067 missense probably benign 0.30
R1532:Crispld2 UTSW 8 120023572 missense probably benign
R1715:Crispld2 UTSW 8 120023649 missense possibly damaging 0.75
R1865:Crispld2 UTSW 8 120010567 missense probably benign 0.00
R1953:Crispld2 UTSW 8 120015296 missense probably damaging 1.00
R2161:Crispld2 UTSW 8 120015339 missense probably damaging 1.00
R2306:Crispld2 UTSW 8 120026071 missense probably damaging 0.99
R3774:Crispld2 UTSW 8 120029266 missense probably damaging 0.99
R3776:Crispld2 UTSW 8 120029266 missense probably damaging 0.99
R6044:Crispld2 UTSW 8 120010671 missense possibly damaging 0.66
R6485:Crispld2 UTSW 8 120029309 missense probably damaging 0.99
R6861:Crispld2 UTSW 8 120026113 missense probably damaging 1.00
R7792:Crispld2 UTSW 8 120031070 missense probably benign 0.01
R8814:Crispld2 UTSW 8 120015345 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TCACAGGTTAGAGGCACAGC -3'
(R):5'- TAAACGAAGAGCTGAGCCTG -3'

Sequencing Primer
(F):5'- GCCTGTGCTCTGACAGTC -3'
(R):5'- TCACACTCAGGTAGGGGA -3'
Posted On2014-12-04