Mutagenetix > Incidental Mutation

Incidental Mutation 'R0311:Mbtd1'

25222

Institutional Source

Beutler Lab

Gene Symbol

Mbtd1

Ensembl Gene

ENSMUSG00000059474

Gene Name

mbt domain containing 1

Synonyms

hemp

MMRRC Submission

038521-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0311 (G1)

Quality Score

215

Status

Validated

Chromosome

Chromosomal Location

93885852-93946985 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 93921357 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000103486 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063645] [ENSMUST00000063718] [ENSMUST00000107850] [ENSMUST00000107852] [ENSMUST00000107853] [ENSMUST00000107854]

AlphaFold

Q6P5G3

Predicted Effect

probably null
Transcript: ENSMUST00000063645

SMART Domains

Protein: ENSMUSP00000070248
Gene: ENSMUSG00000059474

Domain	Start	End	E-Value	Type
low complexity region	7	24	N/A	INTRINSIC
PDB:2W0T\|A	52	74	7e-6	PDB
low complexity region	75	90	N/A	INTRINSIC
low complexity region	114	130	N/A	INTRINSIC
MBT	144	248	3.11e-22	SMART
MBT	256	357	1.28e-41	SMART
MBT	361	459	1.61e-38	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000063718

SMART Domains

Protein: ENSMUSP00000065442
Gene: ENSMUSG00000059474

Domain	Start	End	E-Value	Type
low complexity region	29	46	N/A	INTRINSIC
PDB:2W0T\|A	74	96	7e-6	PDB
low complexity region	97	112	N/A	INTRINSIC
low complexity region	136	152	N/A	INTRINSIC
MBT	166	270	3.11e-22	SMART
MBT	278	379	1.28e-41	SMART
MBT	383	481	1.61e-38	SMART
MBT	489	585	4.11e-54	SMART
low complexity region	586	614	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000107850

SMART Domains

Protein: ENSMUSP00000103482
Gene: ENSMUSG00000059474

Domain	Start	End	E-Value	Type
low complexity region	7	24	N/A	INTRINSIC
Blast:MBT	25	52	2e-9	BLAST
PDB:2W0T\|A	52	74	2e-6	PDB
low complexity region	75	90	N/A	INTRINSIC
low complexity region	114	130	N/A	INTRINSIC
PDB:4C5I\|B	131	201	5e-37	PDB
Blast:MBT	144	201	1e-35	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000107852

SMART Domains

Protein: ENSMUSP00000103484
Gene: ENSMUSG00000059474

Domain	Start	End	E-Value	Type
low complexity region	7	24	N/A	INTRINSIC
PDB:2W0T\|A	52	74	5e-6	PDB
low complexity region	75	90	N/A	INTRINSIC
low complexity region	114	130	N/A	INTRINSIC
MBT	144	248	3.11e-22	SMART
MBT	256	357	1.28e-41	SMART
MBT	361	433	1.29e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000107853

SMART Domains

Protein: ENSMUSP00000103485
Gene: ENSMUSG00000059474

Domain	Start	End	E-Value	Type
low complexity region	7	24	N/A	INTRINSIC
PDB:2W0T\|A	52	74	1e-6	PDB
low complexity region	75	90	N/A	INTRINSIC
low complexity region	114	130	N/A	INTRINSIC
MBT	144	248	1.2e-24	SMART
MBT	256	357	4.8e-44	SMART
MBT	361	459	6.1e-41	SMART
MBT	467	563	1.6e-56	SMART
low complexity region	564	592	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000107854

SMART Domains

Protein: ENSMUSP00000103486
Gene: ENSMUSG00000059474

Domain	Start	End	E-Value	Type
low complexity region	7	24	N/A	INTRINSIC
PDB:2W0T\|A	52	74	1e-6	PDB
low complexity region	75	90	N/A	INTRINSIC
low complexity region	114	130	N/A	INTRINSIC
MBT	144	248	1.2e-24	SMART
MBT	256	357	4.9e-44	SMART
MBT	361	459	6.2e-41	SMART
MBT	467	563	1.6e-56	SMART
low complexity region	564	592	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138281

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140880

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150237

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155518

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155841

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.6%
20x: 91.6%

Validation Efficiency

100% (43/43)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality and severe abnormalities in hematopoietic stem cell function and skeletal formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	A	C	7: 120,402,904	M1547L	probably damaging	Het
Abcb4	A	G	5: 8,934,243	K658E	probably benign	Het
Abr	A	G	11: 76,509,127	S15P	possibly damaging	Het
Adgrb2	G	C	4: 130,017,129	A1168P	probably damaging	Het
Adgre4	A	T	17: 55,802,010	E339V	probably benign	Het
Asprv1	T	C	6: 86,628,840	W223R	probably damaging	Het
Ccdc89	A	G	7: 90,426,693	E37G	probably damaging	Het
Cd48	C	A	1: 171,699,580	Y191*	probably null	Het
Chd4	T	C	6: 125,101,665	I257T	probably benign	Het
Clca4b	T	C	3: 144,932,496	M2V	probably benign	Het
Dnah11	A	T	12: 118,127,133	D1025E	probably benign	Het
Erich5	A	G	15: 34,472,939	*363W	probably null	Het
Etl4	A	G	2: 20,807,129	D1341G	probably damaging	Het
Fbxw11	A	G	11: 32,722,083	T184A	probably benign	Het
Fktn	A	G	4: 53,744,620	Q300R	probably benign	Het
G3bp1	T	C	11: 55,498,626	F383L	probably damaging	Het
Gdpd3	G	A	7: 126,767,189	R66Q	possibly damaging	Het
Hexb	A	G	13: 97,183,819		probably benign	Het
Kdm4b	A	G	17: 56,386,200	R346G	probably benign	Het
Med23	T	A	10: 24,897,358	C653S	possibly damaging	Het
Nwd2	A	T	5: 63,804,998	I642L	probably damaging	Het
Olfr1444	A	G	19: 12,861,869	I31M	probably benign	Het
Olfr1448	T	A	19: 12,920,096	Y71F	possibly damaging	Het
Olfr912	T	C	9: 38,539,297	V134A	probably benign	Het
Pbld2	T	C	10: 63,054,507		probably null	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Pkd1l3	G	A	8: 109,623,663	S380N	probably benign	Het
Plpp2	C	T	10: 79,527,580	R77K	probably damaging	Het
Pym1	G	T	10: 128,765,984	R168L	possibly damaging	Het
Rbm4	T	C	19: 4,787,556	Y300C	probably damaging	Het
Rnf207	A	G	4: 152,315,779	C175R	probably damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Speg	T	C	1: 75,430,937	V3196A	probably damaging	Het
Syne1	T	A	10: 5,348,943	I1048L	possibly damaging	Het
Th	T	C	7: 142,896,041	E41G	probably damaging	Het
Tmx4	T	A	2: 134,598,526	*336L	probably null	Het
Tnfrsf18	T	C	4: 156,026,415	V10A	possibly damaging	Het
Tnxb	A	T	17: 34,716,984	I2670F	probably damaging	Het
Tpx2	T	C	2: 152,890,492	V562A	probably damaging	Het
Vmn2r73	A	G	7: 85,871,789	S324P	probably benign	Het
Vps18	T	C	2: 119,297,365	Y890H	probably benign	Het
Ythdc1	G	A	5: 86,835,705	D670N	probably damaging	Het

Other mutations in Mbtd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00814:Mbtd1	APN	11	93943840	missense	possibly damaging	0.94
IGL00819:Mbtd1	APN	11	93931811	critical splice acceptor site	probably null
IGL01140:Mbtd1	APN	11	93924432	missense	probably damaging	1.00
IGL01553:Mbtd1	APN	11	93923214	missense	probably benign	0.35
IGL01893:Mbtd1	APN	11	93921412	missense	probably null
IGL02218:Mbtd1	APN	11	93931803	splice site	probably benign
IGL02406:Mbtd1	APN	11	93908858	missense	probably damaging	1.00
IGL03002:Mbtd1	APN	11	93924490	missense	probably benign	0.15
IGL03347:Mbtd1	APN	11	93923179	missense	probably benign	0.01
R0027:Mbtd1	UTSW	11	93924549	missense	possibly damaging	0.85
R0027:Mbtd1	UTSW	11	93924549	missense	possibly damaging	0.85
R0513:Mbtd1	UTSW	11	93932212	splice site	probably null
R0646:Mbtd1	UTSW	11	93905212	missense	probably damaging	1.00
R0734:Mbtd1	UTSW	11	93923146	missense	probably damaging	1.00
R0835:Mbtd1	UTSW	11	93931839	missense	probably benign	0.23
R1295:Mbtd1	UTSW	11	93910359	missense	probably damaging	0.99
R1296:Mbtd1	UTSW	11	93910359	missense	probably damaging	0.99
R1996:Mbtd1	UTSW	11	93932396	frame shift	probably null
R2157:Mbtd1	UTSW	11	93910388	missense	probably benign	0.20
R3977:Mbtd1	UTSW	11	93905175	missense	probably benign
R4435:Mbtd1	UTSW	11	93932222	missense	probably benign
R4589:Mbtd1	UTSW	11	93921419	missense	probably damaging	1.00
R4647:Mbtd1	UTSW	11	93924611	missense	probably damaging	1.00
R4824:Mbtd1	UTSW	11	93925702	missense	probably benign	0.00
R4919:Mbtd1	UTSW	11	93923148	splice site	probably null
R5045:Mbtd1	UTSW	11	93931815	missense	probably benign	0.26
R5095:Mbtd1	UTSW	11	93929671	missense	probably damaging	1.00
R5227:Mbtd1	UTSW	11	93924648	missense	possibly damaging	0.54
R5619:Mbtd1	UTSW	11	93929879	splice site	probably null
R6057:Mbtd1	UTSW	11	93929659	missense	probably damaging	0.99
R6293:Mbtd1	UTSW	11	93932232	missense	possibly damaging	0.79
R6294:Mbtd1	UTSW	11	93932232	missense	possibly damaging	0.79
R6295:Mbtd1	UTSW	11	93932232	missense	possibly damaging	0.79
R6297:Mbtd1	UTSW	11	93932232	missense	possibly damaging	0.79
R6998:Mbtd1	UTSW	11	93924612	missense	probably damaging	1.00
R7423:Mbtd1	UTSW	11	93943796	missense	probably benign	0.38
R7519:Mbtd1	UTSW	11	93908899	missense	probably damaging	1.00
R8250:Mbtd1	UTSW	11	93910350	missense	probably damaging	1.00
R9180:Mbtd1	UTSW	11	93932392	missense	probably damaging	1.00
R9181:Mbtd1	UTSW	11	93912415	missense	probably benign
R9215:Mbtd1	UTSW	11	93943802	missense	possibly damaging	0.67
R9446:Mbtd1	UTSW	11	93943682	missense	unknown
R9474:Mbtd1	UTSW	11	93925685	missense	probably benign
R9575:Mbtd1	UTSW	11	93908938	critical splice donor site	probably null
R9696:Mbtd1	UTSW	11	93932392	missense	probably damaging	1.00
X0024:Mbtd1	UTSW	11	93924549	missense	possibly damaging	0.85
Z1177:Mbtd1	UTSW	11	93912459	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGGATCACGTTGAATGAAGCCTGTT -3'
(R):5'- ACTGTTACTGGGAGACAAGTTGGAGA -3'

Sequencing Primer
(F):5'- CTCTACTCTTGGGCAAGATTTTTAG -3'
(R):5'- gagtgtaatagactgcaaatgcc -3'

Posted On

2013-04-16