Mutagenetix > Incidental Mutation

Incidental Mutation 'R2504:Mast4'

252220

Institutional Source

Beutler Lab

Gene Symbol

Mast4

Ensembl Gene

ENSMUSG00000034751

Gene Name

microtubule associated serine/threonine kinase family member 4

Synonyms

4930420O11Rik

MMRRC Submission

040412-MU

Accession Numbers

Genbank: NM_175171.3; EnsemblENSMUST00000167058 , ENSMUST00000167462, ENSMUST00000166726, ENSMUST00000164111 , ENSMUST00000166336, ENSMUST00000099202, ENSMUST00000172264, ENSMUST00000171791, ENSMUST00000091273

Essential gene?

Probably non essential (E-score: 0.241) question?

Stock #

R2504 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

102732486-103334497 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 102738639 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 1215 (I1215N)

Ref Sequence

ENSEMBL: ENSMUSP00000131651 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099202] [ENSMUST00000166726] [ENSMUST00000167058] [ENSMUST00000167462] [ENSMUST00000170878] [ENSMUST00000171791] [ENSMUST00000172138]

AlphaFold

Q811L6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099202
AA Change: I1230N

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000096808
Gene: ENSMUSG00000034751
AA Change: I1230N

Domain	Start	End	E-Value	Type
low complexity region	13	38	N/A	INTRINSIC
Pfam:DUF1908	76	353	2.2e-146	PFAM
S_TKc	391	664	4.13e-98	SMART
S_TK_X	665	729	3.79e-2	SMART
low complexity region	745	758	N/A	INTRINSIC
low complexity region	818	831	N/A	INTRINSIC
low complexity region	840	857	N/A	INTRINSIC
low complexity region	925	960	N/A	INTRINSIC
PDZ	970	1050	2.34e-15	SMART
low complexity region	1070	1087	N/A	INTRINSIC
low complexity region	1111	1122	N/A	INTRINSIC
low complexity region	1127	1139	N/A	INTRINSIC
low complexity region	1142	1164	N/A	INTRINSIC
low complexity region	1202	1219	N/A	INTRINSIC
low complexity region	1290	1306	N/A	INTRINSIC
low complexity region	1345	1361	N/A	INTRINSIC
low complexity region	1937	1953	N/A	INTRINSIC
low complexity region	1996	2010	N/A	INTRINSIC
low complexity region	2150	2161	N/A	INTRINSIC
low complexity region	2296	2307	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000166726

SMART Domains

Protein: ENSMUSP00000132263
Gene: ENSMUSG00000034751

Domain	Start	End	E-Value	Type
low complexity region	23	51	N/A	INTRINSIC
Pfam:DUF1908	256	530	4.2e-145	PFAM
S_TKc	568	841	4.13e-98	SMART
S_TK_X	842	906	3.79e-2	SMART
low complexity region	922	935	N/A	INTRINSIC
low complexity region	995	1008	N/A	INTRINSIC
low complexity region	1035	1070	N/A	INTRINSIC
PDZ	1080	1160	2.34e-15	SMART
low complexity region	1180	1201	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000167058
AA Change: I1407N

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000128464
Gene: ENSMUSG00000034751
AA Change: I1407N

Domain	Start	End	E-Value	Type
low complexity region	23	51	N/A	INTRINSIC
Pfam:DUF1908	256	529	5.1e-134	PFAM
S_TKc	568	841	4.13e-98	SMART
S_TK_X	842	906	3.79e-2	SMART
low complexity region	922	935	N/A	INTRINSIC
low complexity region	995	1008	N/A	INTRINSIC
low complexity region	1017	1034	N/A	INTRINSIC
low complexity region	1102	1137	N/A	INTRINSIC
PDZ	1147	1227	2.34e-15	SMART
low complexity region	1247	1264	N/A	INTRINSIC
low complexity region	1288	1299	N/A	INTRINSIC
low complexity region	1304	1316	N/A	INTRINSIC
low complexity region	1319	1341	N/A	INTRINSIC
low complexity region	1379	1396	N/A	INTRINSIC
low complexity region	1467	1483	N/A	INTRINSIC
low complexity region	1522	1538	N/A	INTRINSIC
low complexity region	2114	2130	N/A	INTRINSIC
low complexity region	2173	2187	N/A	INTRINSIC
low complexity region	2327	2338	N/A	INTRINSIC
low complexity region	2473	2484	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167462

SMART Domains

Protein: ENSMUSP00000131910
Gene: ENSMUSG00000034751

Domain	Start	End	E-Value	Type
Pfam:DUF1908	64	338	3e-145	PFAM
S_TKc	376	649	4.13e-98	SMART
S_TK_X	650	714	3.79e-2	SMART
low complexity region	730	743	N/A	INTRINSIC
low complexity region	803	816	N/A	INTRINSIC
low complexity region	843	878	N/A	INTRINSIC
PDZ	888	968	2.34e-15	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000170878

SMART Domains

Protein: ENSMUSP00000127880
Gene: ENSMUSG00000021624

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
PDB:3T6Q\|B	21	86	3e-38	PDB
SCOP:d1m0za_	35	84	4e-4	SMART
Blast:LRR	51	75	1e-5	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000171791
AA Change: I1215N

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000131651
Gene: ENSMUSG00000034751
AA Change: I1215N

Domain	Start	End	E-Value	Type
Pfam:DUF1908	64	338	1.2e-144	PFAM
S_TKc	376	649	4.13e-98	SMART
S_TK_X	650	714	3.79e-2	SMART
low complexity region	730	743	N/A	INTRINSIC
low complexity region	803	816	N/A	INTRINSIC
low complexity region	825	842	N/A	INTRINSIC
low complexity region	910	945	N/A	INTRINSIC
PDZ	955	1035	2.34e-15	SMART
low complexity region	1055	1072	N/A	INTRINSIC
low complexity region	1096	1107	N/A	INTRINSIC
low complexity region	1112	1124	N/A	INTRINSIC
low complexity region	1127	1149	N/A	INTRINSIC
low complexity region	1187	1204	N/A	INTRINSIC
low complexity region	1275	1291	N/A	INTRINSIC
low complexity region	1330	1346	N/A	INTRINSIC
low complexity region	1922	1938	N/A	INTRINSIC
low complexity region	1981	1995	N/A	INTRINSIC
low complexity region	2135	2146	N/A	INTRINSIC
low complexity region	2281	2292	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172138

Predicted Effect

unknown
Transcript: ENSMUST00000194446
AA Change: I1239N

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit malocclusion. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock

Total: 113 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	G	A	15: 8,219,216	E1750K	probably damaging	Het
4933425L06Rik	A	G	13: 105,109,742	I270M	probably benign	Het
Aatk	T	C	11: 120,018,855	D28G	probably benign	Het
Abcg1	T	A	17: 31,092,395	S125T	probably damaging	Het
Actbl2	T	C	13: 111,256,183	S351P	possibly damaging	Het
Ankrd34b	A	G	13: 92,439,061		probably null	Het
BC030867	T	C	11: 102,255,296	Y133H	possibly damaging	Het
BC051665	C	T	13: 60,782,654	V295I	probably benign	Het
C1qtnf2	A	G	11: 43,491,156	N265S	probably damaging	Het
Ccdc14	C	T	16: 34,721,850	R573*	probably null	Het
Cd55b	A	T	1: 130,409,875	Y247N	probably damaging	Het
Celsr2	A	T	3: 108,413,591	V635E	probably benign	Het
Clec16a	T	C	16: 10,559,687		probably benign	Het
Clec4b1	A	G	6: 123,065,945	Y41C	probably damaging	Het
Cntn5	A	T	9: 10,172,121	D19E	probably benign	Het
Cop1	A	G	1: 159,232,805	N53S	probably damaging	Het
Csad	A	T	15: 102,188,667	M1K	probably null	Het
Cyb5rl	A	G	4: 107,080,945	I200V	probably benign	Het
Cyp26a1	A	G	19: 37,698,342	T81A	probably damaging	Het
Cyp2d12	A	T	15: 82,559,036	H433L	probably benign	Het
D7Ertd443e	T	A	7: 134,349,479		probably null	Het
Dennd1b	A	G	1: 139,170,170		probably benign	Het
Dmap1	G	T	4: 117,675,298	T357K	probably damaging	Het
Dzip1	G	T	14: 118,881,044	T759K	probably benign	Het
Elmo2	A	G	2: 165,298,687	V300A	probably damaging	Het
Eml5	T	C	12: 98,844,105	D864G	possibly damaging	Het
Ep400	A	G	5: 110,668,645	V2670A	probably damaging	Het
Epha3	T	A	16: 63,603,625	I534F	probably damaging	Het
Epha4	A	C	1: 77,382,991	Y742D	probably damaging	Het
Ergic2	A	G	6: 148,204,774		probably null	Het
Ero1l	A	T	14: 45,299,088		probably null	Het
Fam229a	A	G	4: 129,491,486	D70G	probably damaging	Het
Fbn2	C	T	18: 58,093,359	R781Q	probably damaging	Het
Fbxo16	A	T	14: 65,270,714		probably benign	Het
Fbxo39	T	A	11: 72,317,285	S154R	probably benign	Het
Fer	T	A	17: 63,991,580		probably null	Het
Filip1l	A	T	16: 57,571,047	D428V	probably damaging	Het
Filip1l	A	G	16: 57,570,662	I538V	possibly damaging	Het
Fsip2	T	C	2: 82,979,610	I2091T	possibly damaging	Het
Glyat	A	C	19: 12,651,398	T186P	possibly damaging	Het
Gm10604	A	G	4: 11,980,083	S74P	unknown	Het
Gm4787	T	G	12: 81,379,137	K82N	possibly damaging	Het
Hectd4	T	C	5: 121,220,620	I50T	unknown	Het
Hectd4	T	C	5: 121,263,967	S373P	possibly damaging	Het
Hmcn1	A	T	1: 150,686,867	C2313*	probably null	Het
Igfn1	A	T	1: 135,969,316	S1171T	probably benign	Het
Ints8	T	C	4: 11,241,642	D267G	probably benign	Het
Itln1	A	G	1: 171,529,159	C251R	probably damaging	Het
Jcad	C	T	18: 4,674,026	T596M	probably damaging	Het
Kcnj16	C	T	11: 111,025,583	T357M	probably benign	Het
Kif13a	G	A	13: 46,814,200	T346M	probably damaging	Het
Klhl24	G	A	16: 20,120,167	A491T	probably benign	Het
Kntc1	C	T	5: 123,778,347	Q748*	probably null	Het
Krt25	T	A	11: 99,317,296	K369*	probably null	Het
Krt75	C	T	15: 101,568,031	R433Q	probably benign	Het
Krt76	A	G	15: 101,884,858	F582L	unknown	Het
Lysmd1	G	A	3: 95,138,397	V182I	probably benign	Het
Mab21l2	T	A	3: 86,547,555	E46V	probably damaging	Het
Magi2	A	T	5: 20,358,936	K355N	probably damaging	Het
March10	T	C	11: 105,385,572	D630G	probably damaging	Het
Nckap1	G	A	2: 80,530,218	T523I	probably benign	Het
Nexmif	T	A	X: 104,084,393	D1306V	probably damaging	Het
Nfkb1	A	C	3: 135,589,329	I918R	possibly damaging	Het
Nup50	A	T	15: 84,933,658	T93S	probably benign	Het
Nwd2	T	C	5: 63,804,374	Y434H	probably benign	Het
Olfr61	T	C	7: 140,638,484	V261A	probably benign	Het
Osbpl1a	C	A	18: 12,905,031	V288L	probably benign	Het
Pan3	A	G	5: 147,527,036	E562G	possibly damaging	Het
Pappa	T	A	4: 65,180,889	Y548*	probably null	Het
Phf3	A	T	1: 30,810,789	L1181Q	probably damaging	Het
Phip	T	C	9: 82,915,339	H537R	possibly damaging	Het
Pkhd1l1	T	C	15: 44,485,428	I240T	probably damaging	Het
Pole	G	A	5: 110,290,502		probably null	Het
Polq	T	A	16: 37,011,942	S15T	unknown	Het
Prrt2	T	C	7: 127,020,224	E23G	possibly damaging	Het
Prss37	A	T	6: 40,517,826		probably null	Het
Prune2	T	C	19: 17,000,036	L45P	probably damaging	Het
Psd	A	T	19: 46,324,913	M6K	possibly damaging	Het
Psmd1	A	G	1: 86,089,997	E510G	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Pxdn	T	A	12: 30,003,406	I1194N	probably damaging	Het
Rbp3	C	T	14: 33,956,018	T641M	probably damaging	Het
Rgmb	C	A	17: 15,807,647	R270L	probably benign	Het
Rpgrip1l	A	G	8: 91,280,716		probably null	Het
Rps2	G	A	17: 24,720,379		probably benign	Het
Rsbn1l	G	T	5: 20,902,366	A550E	probably damaging	Het
S1pr4	C	T	10: 81,499,304	R112H	probably benign	Het
Scfd2	T	C	5: 74,531,177	N148S	probably damaging	Het
Scin	C	T	12: 40,081,706	M276I	probably benign	Het
Sec24d	T	C	3: 123,353,606	I708T	possibly damaging	Het
Skint11	T	A	4: 114,228,812	F41I	possibly damaging	Het
Slc15a4	A	T	5: 127,617,239	F44Y	possibly damaging	Het
Slc6a18	A	G	13: 73,675,806	Y72H	probably benign	Het
Slc7a11	A	T	3: 50,377,746		probably null	Het
Slc7a14	G	T	3: 31,237,501	N209K	possibly damaging	Het
Sstr2	T	C	11: 113,624,431	C59R	probably damaging	Het
Stab1	A	G	14: 31,163,040		probably null	Het
Stag1	G	T	9: 100,866,210	S475I	probably damaging	Het
Stxbp5l	A	G	16: 37,115,667	Y1183H	probably damaging	Het
Svep1	A	T	4: 58,135,628		probably null	Het
Tm9sf2	A	G	14: 122,158,684	T653A	probably benign	Het
Tmeff1	T	C	4: 48,662,059	S366P	possibly damaging	Het
Tnnt2	G	T	1: 135,852,065	W300L	probably damaging	Het
Traj32	A	G	14: 54,186,103		probably benign	Het
Trp53bp2	A	T	1: 182,441,639	M223L	probably benign	Het
Tsga10	G	A	1: 37,815,677	T246M	probably damaging	Het
Txn2	A	T	15: 77,926,670		probably benign	Het
Ubr3	T	A	2: 69,938,198	F450I	probably damaging	Het
Usp47	T	C	7: 112,104,470		probably null	Het
Vars2	C	T	17: 35,664,793	R244Q	probably damaging	Het
Xrra1	T	A	7: 99,897,596	F251L	probably damaging	Het
Zfp804a	G	A	2: 82,257,519	R564Q	probably benign	Het
Zfp983	T	C	17: 21,658,967	C29R	probably damaging	Het

Other mutations in Mast4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00703:Mast4	APN	13	102770767	nonsense	probably null
IGL00933:Mast4	APN	13	102735366	missense	probably damaging	0.97
IGL01113:Mast4	APN	13	102774236	missense	probably damaging	1.00
IGL01461:Mast4	APN	13	102754068	missense	probably damaging	1.00
IGL01569:Mast4	APN	13	102761015	missense	probably damaging	1.00
IGL01697:Mast4	APN	13	102767893	missense	probably damaging	1.00
IGL01725:Mast4	APN	13	102750512	critical splice donor site	probably null
IGL01734:Mast4	APN	13	102737615	missense	probably damaging	0.98
IGL01738:Mast4	APN	13	102737241	missense	probably damaging	1.00
IGL01739:Mast4	APN	13	102774273	missense	probably damaging	1.00
IGL02299:Mast4	APN	13	102737974	missense	probably benign	0.44
IGL02479:Mast4	APN	13	102742037	missense	probably damaging	1.00
IGL02485:Mast4	APN	13	102735496	missense	probably benign	0.02
IGL02528:Mast4	APN	13	102853823	makesense	probably null
IGL02850:Mast4	APN	13	102754232	missense	probably damaging	1.00
IGL02900:Mast4	APN	13	102735676	missense	probably benign
IGL03064:Mast4	APN	13	102760964	nonsense	probably null
IGL03124:Mast4	APN	13	102738245	missense	probably damaging	1.00
IGL03146:Mast4	APN	13	102737655	missense	probably benign	0.00
IGL03221:Mast4	APN	13	102754256	missense	possibly damaging	0.95
IGL03284:Mast4	APN	13	102751397	missense	probably damaging	1.00
IGL03406:Mast4	APN	13	102737107	missense	possibly damaging	0.46
buck	UTSW	13	102761293	critical splice donor site	probably null
doe	UTSW	13	102905677	missense	possibly damaging	0.85
skinnybones	UTSW	13	102804641	critical splice donor site	probably null
BB010:Mast4	UTSW	13	102772563	missense	probably damaging	0.99
BB020:Mast4	UTSW	13	102772563	missense	probably damaging	0.99
FR4304:Mast4	UTSW	13	102734862	utr 3 prime	probably benign
FR4340:Mast4	UTSW	13	102734857	frame shift	probably null
FR4340:Mast4	UTSW	13	102736317	small insertion	probably benign
FR4548:Mast4	UTSW	13	102736318	small insertion	probably benign
FR4976:Mast4	UTSW	13	102736312	small insertion	probably benign
FR4976:Mast4	UTSW	13	102739247	frame shift	probably null
NA:Mast4	UTSW	13	102742057	missense	probably damaging	1.00
PIT4466001:Mast4	UTSW	13	102804718	missense	probably damaging	1.00
PIT4469001:Mast4	UTSW	13	102804718	missense	probably damaging	1.00
PIT4472001:Mast4	UTSW	13	102804718	missense	probably damaging	1.00
R0009:Mast4	UTSW	13	102742058	missense	probably damaging	1.00
R0063:Mast4	UTSW	13	103334215	start gained	probably benign
R0242:Mast4	UTSW	13	102853842	missense	probably damaging	1.00
R0310:Mast4	UTSW	13	102754161	missense	possibly damaging	0.94
R0395:Mast4	UTSW	13	102735273	missense	probably damaging	1.00
R0454:Mast4	UTSW	13	102751560	missense	probably damaging	1.00
R0646:Mast4	UTSW	13	102758744	splice site	probably benign
R0744:Mast4	UTSW	13	102737387	missense	probably damaging	0.98
R0883:Mast4	UTSW	13	102853900	missense	probably damaging	1.00
R0905:Mast4	UTSW	13	102770784	missense	probably damaging	0.99
R1023:Mast4	UTSW	13	102735496	missense	probably benign	0.02
R1281:Mast4	UTSW	13	102750578	missense	probably damaging	1.00
R1376:Mast4	UTSW	13	102736408	missense	possibly damaging	0.46
R1376:Mast4	UTSW	13	102736408	missense	possibly damaging	0.46
R1473:Mast4	UTSW	13	102772519	missense	probably damaging	1.00
R1572:Mast4	UTSW	13	102736923	missense	possibly damaging	0.51
R1575:Mast4	UTSW	13	102739263	missense	probably damaging	1.00
R1865:Mast4	UTSW	13	102794117	missense	probably damaging	1.00
R2050:Mast4	UTSW	13	102751409	missense	probably damaging	1.00
R2060:Mast4	UTSW	13	102738846	missense	probably damaging	1.00
R2062:Mast4	UTSW	13	102759093	missense	probably benign	0.18
R2106:Mast4	UTSW	13	102750546	missense	probably damaging	1.00
R2118:Mast4	UTSW	13	102754205	missense	probably damaging	1.00
R2143:Mast4	UTSW	13	102735475	missense	possibly damaging	0.89
R2256:Mast4	UTSW	13	102735751	missense	possibly damaging	0.62
R2261:Mast4	UTSW	13	102798207	splice site	probably benign
R2370:Mast4	UTSW	13	102774187	missense	probably damaging	1.00
R2509:Mast4	UTSW	13	102853842	missense	probably damaging	1.00
R2842:Mast4	UTSW	13	102736431	missense	probably benign	0.01
R3087:Mast4	UTSW	13	102853926	splice site	probably benign
R3434:Mast4	UTSW	13	102787379	missense	probably damaging	1.00
R3435:Mast4	UTSW	13	102787379	missense	probably damaging	1.00
R3763:Mast4	UTSW	13	102787419	missense	probably damaging	1.00
R3826:Mast4	UTSW	13	102738811	missense	probably damaging	1.00
R3829:Mast4	UTSW	13	102738811	missense	probably damaging	1.00
R3830:Mast4	UTSW	13	102738811	missense	probably damaging	1.00
R3913:Mast4	UTSW	13	102758669	missense	probably damaging	1.00
R3914:Mast4	UTSW	13	102739321	nonsense	probably null
R4021:Mast4	UTSW	13	102739321	nonsense	probably null
R4022:Mast4	UTSW	13	102739321	nonsense	probably null
R4022:Mast4	UTSW	13	102853869	missense	probably damaging	1.00
R4210:Mast4	UTSW	13	102739205	missense	probably damaging	1.00
R4342:Mast4	UTSW	13	102774248	missense	probably damaging	1.00
R4580:Mast4	UTSW	13	102737258	nonsense	probably null
R4627:Mast4	UTSW	13	103334021	missense	possibly damaging	0.92
R4711:Mast4	UTSW	13	103334119	missense	probably benign	0.01
R4732:Mast4	UTSW	13	102772572	missense	probably damaging	0.99
R4733:Mast4	UTSW	13	102772572	missense	probably damaging	0.99
R4833:Mast4	UTSW	13	102774184	critical splice donor site	probably null
R4995:Mast4	UTSW	13	102905754	intron	probably benign
R5059:Mast4	UTSW	13	102750563	missense	probably damaging	1.00
R5073:Mast4	UTSW	13	102738883	nonsense	probably null
R5101:Mast4	UTSW	13	102736356	missense	probably benign	0.01
R5526:Mast4	UTSW	13	102754215	missense	possibly damaging	0.48
R5599:Mast4	UTSW	13	102737479	missense	probably damaging	1.00
R5673:Mast4	UTSW	13	102794072	missense	probably damaging	1.00
R5694:Mast4	UTSW	13	102774193	nonsense	probably null
R5906:Mast4	UTSW	13	102735744	missense	probably benign	0.31
R5908:Mast4	UTSW	13	102738256	missense	probably damaging	1.00
R5947:Mast4	UTSW	13	102735640	missense	probably benign
R5987:Mast4	UTSW	13	102758734	missense	probably damaging	1.00
R6143:Mast4	UTSW	13	102853883	missense	probably damaging	1.00
R6154:Mast4	UTSW	13	102787421	missense	probably damaging	1.00
R6169:Mast4	UTSW	13	102787421	missense	probably damaging	1.00
R6239:Mast4	UTSW	13	102736209	missense	probably benign	0.01
R6327:Mast4	UTSW	13	102761382	missense	probably damaging	1.00
R6356:Mast4	UTSW	13	102735985	missense	possibly damaging	0.80
R6432:Mast4	UTSW	13	102905677	missense	possibly damaging	0.85
R6522:Mast4	UTSW	13	102761293	critical splice donor site	probably null
R6667:Mast4	UTSW	13	102737496	missense	probably damaging	1.00
R6941:Mast4	UTSW	13	102804714	missense	probably damaging	1.00
R6968:Mast4	UTSW	13	102798078	missense	probably damaging	1.00
R6968:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6970:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6980:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6991:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6992:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6993:Mast4	UTSW	13	102735974	missense	probably benign	0.28
R6993:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R7083:Mast4	UTSW	13	102737715	missense	probably damaging	1.00
R7241:Mast4	UTSW	13	103334000	missense	possibly damaging	0.87
R7242:Mast4	UTSW	13	102738478	missense	probably damaging	1.00
R7246:Mast4	UTSW	13	102794003	missense	probably damaging	1.00
R7332:Mast4	UTSW	13	102751424	missense	possibly damaging	0.61
R7453:Mast4	UTSW	13	102804641	critical splice donor site	probably null
R7514:Mast4	UTSW	13	102787426	nonsense	probably null
R7697:Mast4	UTSW	13	102739203	missense	probably damaging	1.00
R7820:Mast4	UTSW	13	102754088	missense	probably damaging	1.00
R7874:Mast4	UTSW	13	102739275	missense	probably damaging	1.00
R7933:Mast4	UTSW	13	102772563	missense	probably damaging	0.99
R8042:Mast4	UTSW	13	102781245	missense	probably damaging	0.96
R8060:Mast4	UTSW	13	102737676	missense	possibly damaging	0.89
R8172:Mast4	UTSW	13	102953125	critical splice donor site	probably null
R8206:Mast4	UTSW	13	102735739	missense	probably damaging	1.00
R8248:Mast4	UTSW	13	102738721	missense	probably damaging	1.00
R8283:Mast4	UTSW	13	102758669	missense	probably damaging	1.00
R8346:Mast4	UTSW	13	102751478	missense	probably damaging	0.99
R8434:Mast4	UTSW	13	102761392	missense	probably damaging	1.00
R8796:Mast4	UTSW	13	102783391	missense	probably benign	0.07
R8850:Mast4	UTSW	13	102758666	missense	probably damaging	1.00
R9012:Mast4	UTSW	13	102798098	missense	probably benign	0.05
R9375:Mast4	UTSW	13	102781245	missense	probably damaging	0.99
R9389:Mast4	UTSW	13	103333930	missense	probably benign	0.00
R9404:Mast4	UTSW	13	102751425	missense	probably damaging	1.00
R9520:Mast4	UTSW	13	102789024	missense	probably damaging	1.00
R9525:Mast4	UTSW	13	102736436	missense	probably benign	0.00
R9526:Mast4	UTSW	13	102737085	missense	probably benign	0.00
R9709:Mast4	UTSW	13	102774203	missense	probably damaging	1.00
R9790:Mast4	UTSW	13	102754197	missense	probably benign	0.01
R9791:Mast4	UTSW	13	102754197	missense	probably benign	0.01
RF005:Mast4	UTSW	13	102736307	small insertion	probably benign
RF015:Mast4	UTSW	13	102739247	frame shift	probably null
RF019:Mast4	UTSW	13	102736307	small insertion	probably benign
RF037:Mast4	UTSW	13	102739241	small deletion	probably benign
RF039:Mast4	UTSW	13	102739241	small deletion	probably benign
RF040:Mast4	UTSW	13	102739241	small deletion	probably benign
Z1088:Mast4	UTSW	13	102738519	missense	probably damaging	1.00
Z1176:Mast4	UTSW	13	102738460	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACCTCTAGGCTATGCTTGC -3'
(R):5'- CAATTCTCCAGCAGGTTCAGG -3'

Sequencing Primer
(F):5'- CGGGAGCACAGAAGCTTCTTG -3'
(R):5'- AGCAGGTTCAGGGCACATC -3'

Posted On

2014-12-04