Incidental Mutation 'R2851:U2surp'
ID252225
Institutional Source Beutler Lab
Gene Symbol U2surp
Ensembl Gene ENSMUSG00000032407
Gene NameU2 snRNP-associated SURP domain containing
Synonyms2610101N10Rik
MMRRC Submission 040444-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R2851 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location95456898-95511996 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 95500682 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078374] [ENSMUST00000079659] [ENSMUST00000191213] [ENSMUST00000217176]
Predicted Effect probably benign
Transcript: ENSMUST00000078374
SMART Domains Protein: ENSMUSP00000077482
Gene: ENSMUSG00000032407

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
low complexity region 54 75 N/A INTRINSIC
coiled coil region 148 186 N/A INTRINSIC
RRM 231 307 1.85e-18 SMART
low complexity region 313 323 N/A INTRINSIC
SWAP 384 438 1.07e-20 SMART
RPR 493 632 1.42e-41 SMART
internal_repeat_1 648 665 6.09e-7 PROSPERO
internal_repeat_1 678 698 6.09e-7 PROSPERO
coiled coil region 742 769 N/A INTRINSIC
cwf21 792 843 6.31e-17 SMART
low complexity region 881 933 N/A INTRINSIC
low complexity region 939 985 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000079659
SMART Domains Protein: ENSMUSP00000078602
Gene: ENSMUSG00000032407

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
coiled coil region 192 230 N/A INTRINSIC
RRM 275 351 1.85e-18 SMART
low complexity region 357 367 N/A INTRINSIC
SWAP 428 482 1.07e-20 SMART
RPR 537 676 1.42e-41 SMART
internal_repeat_1 692 709 1.14e-6 PROSPERO
internal_repeat_1 722 742 1.14e-6 PROSPERO
coiled coil region 786 813 N/A INTRINSIC
cwf21 836 887 6.31e-17 SMART
low complexity region 925 977 N/A INTRINSIC
low complexity region 983 1029 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000185515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186076
Predicted Effect probably benign
Transcript: ENSMUST00000190019
Predicted Effect probably benign
Transcript: ENSMUST00000191213
SMART Domains Protein: ENSMUSP00000140614
Gene: ENSMUSG00000032407

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
coiled coil region 192 230 N/A INTRINSIC
RRM 275 351 7.8e-21 SMART
low complexity region 357 367 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000217176
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2cl T C 9: 110,894,135 S636P probably damaging Het
Arhgef4 A C 1: 34,724,048 D795A unknown Het
Bank1 A T 3: 136,242,940 S159T possibly damaging Het
Catsperd A G 17: 56,660,169 probably null Het
Ccdc85a A G 11: 28,392,942 probably benign Het
Ceacam11 T C 7: 17,978,526 I300T probably benign Het
Cmtm5 A G 14: 54,938,055 probably benign Het
Cnn3 C T 3: 121,450,053 probably benign Het
Col12a1 A T 9: 79,678,332 N1254K probably damaging Het
Crispld2 T A 8: 120,014,089 L107Q probably damaging Het
Ctr9 C T 7: 111,053,446 R984C unknown Het
Cyp1b1 T C 17: 79,710,220 N502S probably benign Het
Cyp51 A T 5: 4,099,183 D231E probably damaging Het
Depdc5 A G 5: 32,924,171 E559G probably damaging Het
Dscam T C 16: 96,622,715 T1677A possibly damaging Het
Dzip1 A C 14: 118,922,445 M117R possibly damaging Het
Ednrb G T 14: 103,821,674 S305R probably benign Het
Emilin1 A G 5: 30,917,165 D250G probably benign Het
Frrs1 A G 3: 116,885,129 N200S probably benign Het
Fstl5 T A 3: 76,429,738 probably benign Het
Gmcl1 A C 6: 86,726,177 S92A probably damaging Het
Gpr62 T C 9: 106,464,712 E339G probably benign Het
Hspd1 A T 1: 55,081,097 D315E probably damaging Het
Il19 A G 1: 130,935,957 V99A possibly damaging Het
Itga9 G A 9: 118,636,536 E153K probably damaging Het
Itgad T A 7: 128,204,560 V42E probably benign Het
Krt82 T C 15: 101,548,435 Y170C probably damaging Het
Map4k4 T A 1: 40,000,755 probably benign Het
Mdc1 T A 17: 35,849,010 V670D probably benign Het
Mfsd4b2 T A 10: 39,922,123 S79C probably benign Het
Mre11a A G 9: 14,826,547 E599G probably benign Het
Mthfsd G A 8: 121,105,773 T60I probably benign Het
Mycbp2 A T 14: 103,144,333 F3724I probably damaging Het
Nceh1 A G 3: 27,241,355 Y255C probably damaging Het
Ncoa2 C T 1: 13,186,889 V129I probably damaging Het
Ndufb5 T C 3: 32,746,451 F58L probably damaging Het
Npsr1 A G 9: 24,310,005 probably benign Het
Obscn C A 11: 59,030,018 probably null Het
Pdzd7 C G 19: 45,027,674 V1003L probably benign Het
Pias3 A G 3: 96,703,537 E377G possibly damaging Het
Pilra T A 5: 137,836,080 M14L probably benign Het
Pkhd1 T C 1: 20,058,302 Q4059R probably benign Het
Ppa2 A T 3: 133,321,003 probably null Het
Proser1 G A 3: 53,480,545 A885T probably benign Het
Robo2 A G 16: 73,961,888 I665T probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Secisbp2 G A 13: 51,654,635 probably null Het
Setbp1 T A 18: 78,923,996 Q171L probably benign Het
Spata1 A G 3: 146,487,540 L96P possibly damaging Het
Srprb G A 9: 103,198,839 Q800* probably null Het
Stk11ip A G 1: 75,529,267 probably benign Het
Tbl3 T C 17: 24,702,583 T445A probably damaging Het
Tdrd12 G A 7: 35,485,373 T705M probably damaging Het
Tek A G 4: 94,820,224 T340A probably benign Het
Timm22 G A 11: 76,414,099 A188T probably damaging Het
Tmeff1 T A 4: 48,604,692 probably null Het
Tmprss12 C A 15: 100,282,415 T112K possibly damaging Het
Vmn2r84 T A 10: 130,394,167 E25D probably benign Het
Wdr62 A T 7: 30,261,437 N22K possibly damaging Het
Wdr78 A G 4: 103,096,661 S114P probably benign Het
Zfp653 A T 9: 22,057,566 D426E probably benign Het
Zfyve28 G A 5: 34,196,662 P834L probably damaging Het
Zkscan16 A G 4: 58,957,364 T549A possibly damaging Het
Other mutations in U2surp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:U2surp APN 9 95461524 utr 3 prime probably benign
IGL01122:U2surp APN 9 95490234 missense probably benign 0.02
IGL01985:U2surp APN 9 95490226 missense probably damaging 1.00
IGL01992:U2surp APN 9 95464419 missense possibly damaging 0.46
IGL01992:U2surp APN 9 95482181 missense probably damaging 0.99
IGL02300:U2surp APN 9 95488770 missense probably damaging 1.00
IGL02491:U2surp APN 9 95490220 missense probably damaging 0.98
IGL02503:U2surp APN 9 95502569 missense probably benign 0.03
IGL02615:U2surp APN 9 95493231 missense probably benign 0.00
IGL02628:U2surp APN 9 95472090 missense possibly damaging 0.89
IGL02682:U2surp APN 9 95481651 critical splice donor site probably null
IGL02721:U2surp APN 9 95474435 missense probably benign 0.10
IGL03200:U2surp APN 9 95491391 nonsense probably null
coup UTSW 9 95477512 missense probably damaging 1.00
R0095:U2surp UTSW 9 95500684 splice site probably null
R0373:U2surp UTSW 9 95484443 missense probably benign 0.08
R0376:U2surp UTSW 9 95484443 missense probably benign 0.08
R0377:U2surp UTSW 9 95484443 missense probably benign 0.08
R0416:U2surp UTSW 9 95485607 missense probably damaging 1.00
R0682:U2surp UTSW 9 95484443 missense probably benign 0.08
R0948:U2surp UTSW 9 95461497 utr 3 prime probably benign
R1420:U2surp UTSW 9 95462803 missense probably benign 0.33
R1474:U2surp UTSW 9 95493198 missense possibly damaging 0.49
R1555:U2surp UTSW 9 95466577 missense probably damaging 1.00
R1597:U2surp UTSW 9 95481740 splice site probably benign
R1638:U2surp UTSW 9 95484227 missense possibly damaging 0.95
R1693:U2surp UTSW 9 95511860 start codon destroyed probably null 0.53
R1851:U2surp UTSW 9 95482097 nonsense probably null
R2271:U2surp UTSW 9 95491420 missense possibly damaging 0.80
R2679:U2surp UTSW 9 95476232 missense possibly damaging 0.82
R3769:U2surp UTSW 9 95493697 splice site probably benign
R4596:U2surp UTSW 9 95485628 missense probably damaging 1.00
R4672:U2surp UTSW 9 95493145 missense possibly damaging 0.83
R4763:U2surp UTSW 9 95511791 intron probably benign
R4995:U2surp UTSW 9 95462794 utr 3 prime probably benign
R5805:U2surp UTSW 9 95479304 missense possibly damaging 0.51
R6006:U2surp UTSW 9 95479307 missense probably damaging 0.96
R6249:U2surp UTSW 9 95500816 missense probably benign 0.07
R6260:U2surp UTSW 9 95476157 missense probably damaging 0.99
R6378:U2surp UTSW 9 95491421 missense probably benign 0.41
R6487:U2surp UTSW 9 95477512 missense probably damaging 1.00
R6585:U2surp UTSW 9 95472071 missense probably damaging 1.00
R6721:U2surp UTSW 9 95491104 missense probably damaging 0.99
R6760:U2surp UTSW 9 95493711 missense probably benign 0.27
R7065:U2surp UTSW 9 95485659 missense probably benign 0.01
R7167:U2surp UTSW 9 95481673 missense probably damaging 0.98
R7219:U2surp UTSW 9 95490162 nonsense probably null
R7232:U2surp UTSW 9 95493717 missense probably benign 0.03
R7460:U2surp UTSW 9 95462824 missense unknown
R7547:U2surp UTSW 9 95479349 missense possibly damaging 0.94
R7609:U2surp UTSW 9 95485679 splice site probably null
R7761:U2surp UTSW 9 95488761 missense probably damaging 1.00
X0018:U2surp UTSW 9 95475288 missense probably benign 0.14
X0018:U2surp UTSW 9 95485597 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTCTTAACTGCCTAAATGTTTCTT -3'
(R):5'- TGTGGATGTCATATTTGAAACCATTT -3'

Sequencing Primer
(F):5'- AGGCTGATTTCCAAGCTCAG -3'
(R):5'- AGATGGATGCATCTGGAC -3'
Posted On2014-12-04