Mutagenetix > Incidental Mutations

Incidental Mutation 'R2504:Rbp3'

252228

Institutional Source

Beutler Lab

Gene Symbol

Rbp3

Ensembl Gene

ENSMUSG00000041534

Gene Name

retinol binding protein 3, interstitial

Synonyms

Rbp-3, Irbp

MMRRC Submission

040412-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.756) question?

Stock #

R2504 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

33954003-33964216 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 33956018 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 641 (T641M)

Ref Sequence

ENSEMBL: ENSMUSP00000040249 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035695]

Predicted Effect

probably damaging
Transcript: ENSMUST00000035695
AA Change: T641M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000040249
Gene: ENSMUSG00000041534
AA Change: T641M

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
TSPc	109	308	5.72e-69	SMART
TSPc	416	616	1.98e-63	SMART
TSPc	720	917	5.34e-69	SMART
TSPc	1019	1216	2.13e-68	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interphotoreceptor retinol-binding protein is a large glycoprotein known to bind retinoids and found primarily in the interphotoreceptor matrix of the retina between the retinal pigment epithelium and the photoreceptor cells. It is thought to transport retinoids between the retinal pigment epithelium and the photoreceptors, a critical role in the visual process.The human IRBP gene is approximately 9.5 kbp in length and consists of four exons separated by three introns. The introns are 1.6-1.9 kbp long. The gene is transcribed by photoreceptor and retinoblastoma cells into an approximately 4.3-kilobase mRNA that is translated and processed into a glycosylated protein of 135,000 Da. The amino acid sequence of human IRBP can be divided into four contiguous homology domains with 33-38% identity, suggesting a series of gene duplication events. In the gene, the boundaries of these domains are not defined by exon-intron junctions, as might have been expected. The first three homology domains and part of the fourth are all encoded by the first large exon, which is 3,180 base pairs long. The remainder of the fourth domain is encoded in the last three exons, which are 191, 143, and approximately 740 base pairs long, respectively. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene experience photoreceptor degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 113 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	G	A	15: 8,219,216	E1750K	probably damaging	Het
4933425L06Rik	A	G	13: 105,109,742	I270M	probably benign	Het
Aatk	T	C	11: 120,018,855	D28G	probably benign	Het
Abcg1	T	A	17: 31,092,395	S125T	probably damaging	Het
Actbl2	T	C	13: 111,256,183	S351P	possibly damaging	Het
Ankrd34b	A	G	13: 92,439,061		probably null	Het
BC030867	T	C	11: 102,255,296	Y133H	possibly damaging	Het
BC051665	C	T	13: 60,782,654	V295I	probably benign	Het
C1qtnf2	A	G	11: 43,491,156	N265S	probably damaging	Het
Ccdc14	C	T	16: 34,721,850	R573*	probably null	Het
Cd55b	A	T	1: 130,409,875	Y247N	probably damaging	Het
Celsr2	A	T	3: 108,413,591	V635E	probably benign	Het
Clec16a	T	C	16: 10,559,687		probably benign	Het
Clec4b1	A	G	6: 123,065,945	Y41C	probably damaging	Het
Cntn5	A	T	9: 10,172,121	D19E	probably benign	Het
Cop1	A	G	1: 159,232,805	N53S	probably damaging	Het
Csad	A	T	15: 102,188,667	M1K	probably null	Het
Cyb5rl	A	G	4: 107,080,945	I200V	probably benign	Het
Cyp26a1	A	G	19: 37,698,342	T81A	probably damaging	Het
Cyp2d12	A	T	15: 82,559,036	H433L	probably benign	Het
D7Ertd443e	T	A	7: 134,349,479		probably null	Het
Dennd1b	A	G	1: 139,170,170		probably benign	Het
Dmap1	G	T	4: 117,675,298	T357K	probably damaging	Het
Dzip1	G	T	14: 118,881,044	T759K	probably benign	Het
Elmo2	A	G	2: 165,298,687	V300A	probably damaging	Het
Eml5	T	C	12: 98,844,105	D864G	possibly damaging	Het
Ep400	A	G	5: 110,668,645	V2670A	probably damaging	Het
Epha3	T	A	16: 63,603,625	I534F	probably damaging	Het
Epha4	A	C	1: 77,382,991	Y742D	probably damaging	Het
Ergic2	A	G	6: 148,204,774		probably null	Het
Ero1l	A	T	14: 45,299,088		probably null	Het
Fam229a	A	G	4: 129,491,486	D70G	probably damaging	Het
Fbn2	C	T	18: 58,093,359	R781Q	probably damaging	Het
Fbxo16	A	T	14: 65,270,714		probably benign	Het
Fbxo39	T	A	11: 72,317,285	S154R	probably benign	Het
Fer	T	A	17: 63,991,580		probably null	Het
Filip1l	A	G	16: 57,570,662	I538V	possibly damaging	Het
Filip1l	A	T	16: 57,571,047	D428V	probably damaging	Het
Fsip2	T	C	2: 82,979,610	I2091T	possibly damaging	Het
Glyat	A	C	19: 12,651,398	T186P	possibly damaging	Het
Gm10604	A	G	4: 11,980,083	S74P	unknown	Het
Gm4787	T	G	12: 81,379,137	K82N	possibly damaging	Het
Hectd4	T	C	5: 121,220,620	I50T	unknown	Het
Hectd4	T	C	5: 121,263,967	S373P	possibly damaging	Het
Hmcn1	A	T	1: 150,686,867	C2313*	probably null	Het
Igfn1	A	T	1: 135,969,316	S1171T	probably benign	Het
Ints8	T	C	4: 11,241,642	D267G	probably benign	Het
Itln1	A	G	1: 171,529,159	C251R	probably damaging	Het
Jcad	C	T	18: 4,674,026	T596M	probably damaging	Het
Kcnj16	C	T	11: 111,025,583	T357M	probably benign	Het
Kif13a	G	A	13: 46,814,200	T346M	probably damaging	Het
Klhl24	G	A	16: 20,120,167	A491T	probably benign	Het
Kntc1	C	T	5: 123,778,347	Q748*	probably null	Het
Krt25	T	A	11: 99,317,296	K369*	probably null	Het
Krt75	C	T	15: 101,568,031	R433Q	probably benign	Het
Krt76	A	G	15: 101,884,858	F582L	unknown	Het
Lysmd1	G	A	3: 95,138,397	V182I	probably benign	Het
Mab21l2	T	A	3: 86,547,555	E46V	probably damaging	Het
Magi2	A	T	5: 20,358,936	K355N	probably damaging	Het
March10	T	C	11: 105,385,572	D630G	probably damaging	Het
Mast4	A	T	13: 102,738,639	I1215N	probably damaging	Het
Nckap1	G	A	2: 80,530,218	T523I	probably benign	Het
Nexmif	T	A	X: 104,084,393	D1306V	probably damaging	Het
Nfkb1	A	C	3: 135,589,329	I918R	possibly damaging	Het
Nup50	A	T	15: 84,933,658	T93S	probably benign	Het
Nwd2	T	C	5: 63,804,374	Y434H	probably benign	Het
Olfr61	T	C	7: 140,638,484	V261A	probably benign	Het
Osbpl1a	C	A	18: 12,905,031	V288L	probably benign	Het
Pan3	A	G	5: 147,527,036	E562G	possibly damaging	Het
Pappa	T	A	4: 65,180,889	Y548*	probably null	Het
Phf3	A	T	1: 30,810,789	L1181Q	probably damaging	Het
Phip	T	C	9: 82,915,339	H537R	possibly damaging	Het
Pkhd1l1	T	C	15: 44,485,428	I240T	probably damaging	Het
Pole	G	A	5: 110,290,502		probably null	Het
Polq	T	A	16: 37,011,942	S15T	unknown	Het
Prrt2	T	C	7: 127,020,224	E23G	possibly damaging	Het
Prss37	A	T	6: 40,517,826		probably null	Het
Prune2	T	C	19: 17,000,036	L45P	probably damaging	Het
Psd	A	T	19: 46,324,913	M6K	possibly damaging	Het
Psmd1	A	G	1: 86,089,997	E510G	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Pxdn	T	A	12: 30,003,406	I1194N	probably damaging	Het
Rgmb	C	A	17: 15,807,647	R270L	probably benign	Het
Rpgrip1l	A	G	8: 91,280,716		probably null	Het
Rps2	G	A	17: 24,720,379		probably benign	Het
Rsbn1l	G	T	5: 20,902,366	A550E	probably damaging	Het
S1pr4	C	T	10: 81,499,304	R112H	probably benign	Het
Scfd2	T	C	5: 74,531,177	N148S	probably damaging	Het
Scin	C	T	12: 40,081,706	M276I	probably benign	Het
Sec24d	T	C	3: 123,353,606	I708T	possibly damaging	Het
Skint11	T	A	4: 114,228,812	F41I	possibly damaging	Het
Slc15a4	A	T	5: 127,617,239	F44Y	possibly damaging	Het
Slc6a18	A	G	13: 73,675,806	Y72H	probably benign	Het
Slc7a11	A	T	3: 50,377,746		probably null	Het
Slc7a14	G	T	3: 31,237,501	N209K	possibly damaging	Het
Sstr2	T	C	11: 113,624,431	C59R	probably damaging	Het
Stab1	A	G	14: 31,163,040		probably null	Het
Stag1	G	T	9: 100,866,210	S475I	probably damaging	Het
Stxbp5l	A	G	16: 37,115,667	Y1183H	probably damaging	Het
Svep1	A	T	4: 58,135,628		probably null	Het
Tm9sf2	A	G	14: 122,158,684	T653A	probably benign	Het
Tmeff1	T	C	4: 48,662,059	S366P	possibly damaging	Het
Tnnt2	G	T	1: 135,852,065	W300L	probably damaging	Het
Traj32	A	G	14: 54,186,103		probably benign	Het
Trp53bp2	A	T	1: 182,441,639	M223L	probably benign	Het
Tsga10	G	A	1: 37,815,677	T246M	probably damaging	Het
Txn2	A	T	15: 77,926,670		probably benign	Het
Ubr3	T	A	2: 69,938,198	F450I	probably damaging	Het
Usp47	T	C	7: 112,104,470		probably null	Het
Vars2	C	T	17: 35,664,793	R244Q	probably damaging	Het
Xrra1	T	A	7: 99,897,596	F251L	probably damaging	Het
Zfp804a	G	A	2: 82,257,519	R564Q	probably benign	Het
Zfp983	T	C	17: 21,658,967	C29R	probably damaging	Het

Other mutations in Rbp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01364:Rbp3	APN	14	33954188	missense	possibly damaging	0.82
IGL01643:Rbp3	APN	14	33956836	missense	probably benign	0.18
IGL01665:Rbp3	APN	14	33956131	missense	probably benign	0.02
IGL01809:Rbp3	APN	14	33955300	missense	probably damaging	1.00
IGL01975:Rbp3	APN	14	33958645	missense	probably damaging	1.00
IGL02349:Rbp3	APN	14	33955719	missense	probably damaging	0.97
IGL02447:Rbp3	APN	14	33954503	missense	probably damaging	1.00
IGL03192:Rbp3	APN	14	33958583	missense	possibly damaging	0.52
IGL03302:Rbp3	APN	14	33954659	missense	probably damaging	0.97
Behagt	UTSW	14	33954454	missense	probably benign	0.00
jagt	UTSW	14	33956482	missense	probably damaging	0.97
muntre	UTSW	14	33956356	missense	possibly damaging	0.95
Rotwild	UTSW	14	33956018	missense	probably damaging	1.00
P4717OSA:Rbp3	UTSW	14	33955499	missense	probably damaging	0.96
R0234:Rbp3	UTSW	14	33955901	missense	probably damaging	0.98
R0234:Rbp3	UTSW	14	33955901	missense	probably damaging	0.98
R0432:Rbp3	UTSW	14	33954773	missense	probably damaging	1.00
R0469:Rbp3	UTSW	14	33962419	missense	possibly damaging	0.95
R0652:Rbp3	UTSW	14	33958648	missense	possibly damaging	0.89
R0739:Rbp3	UTSW	14	33958647	missense	probably benign	0.28
R0747:Rbp3	UTSW	14	33956278	missense	possibly damaging	0.51
R0836:Rbp3	UTSW	14	33956638	missense	possibly damaging	0.84
R1102:Rbp3	UTSW	14	33956356	missense	possibly damaging	0.95
R1583:Rbp3	UTSW	14	33954524	missense	possibly damaging	0.45
R1589:Rbp3	UTSW	14	33955792	missense	probably damaging	0.99
R1595:Rbp3	UTSW	14	33956198	missense	possibly damaging	0.93
R1720:Rbp3	UTSW	14	33956909	missense	probably benign	0.38
R1830:Rbp3	UTSW	14	33954644	missense	probably benign	0.31
R1982:Rbp3	UTSW	14	33954545	missense	probably damaging	0.99
R1985:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R1985:Rbp3	UTSW	14	33956461	missense	probably benign	0.00
R2007:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2027:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2100:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2101:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2113:Rbp3	UTSW	14	33956057	missense	probably benign	0.00
R2138:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2183:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2248:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2277:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2306:Rbp3	UTSW	14	33962563	missense	probably damaging	1.00
R2696:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2697:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2698:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2920:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2940:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2971:Rbp3	UTSW	14	33954454	missense	probably benign	0.00
R3111:Rbp3	UTSW	14	33954112	missense	probably benign	0.01
R3155:Rbp3	UTSW	14	33957114	missense	probably damaging	0.98
R3156:Rbp3	UTSW	14	33957114	missense	probably damaging	0.98
R3751:Rbp3	UTSW	14	33956012	missense	probably damaging	0.98
R3752:Rbp3	UTSW	14	33956012	missense	probably damaging	0.98
R3851:Rbp3	UTSW	14	33955507	missense	probably damaging	0.98
R4016:Rbp3	UTSW	14	33955390	missense	possibly damaging	0.82
R4276:Rbp3	UTSW	14	33958650	missense	probably benign	0.24
R4277:Rbp3	UTSW	14	33958650	missense	probably benign	0.24
R4278:Rbp3	UTSW	14	33958650	missense	probably benign	0.24
R4382:Rbp3	UTSW	14	33955296	missense	probably benign	0.12
R4383:Rbp3	UTSW	14	33955296	missense	probably benign	0.12
R4385:Rbp3	UTSW	14	33955296	missense	probably benign	0.12
R4625:Rbp3	UTSW	14	33956099	missense	probably benign
R4712:Rbp3	UTSW	14	33960658	missense	probably damaging	0.97
R4812:Rbp3	UTSW	14	33954774	missense	probably damaging	0.99
R4918:Rbp3	UTSW	14	33955411	missense	probably damaging	1.00
R4971:Rbp3	UTSW	14	33954470	missense	probably damaging	0.98
R5262:Rbp3	UTSW	14	33954850	missense	probably damaging	1.00
R5387:Rbp3	UTSW	14	33956413	missense	possibly damaging	0.95
R5468:Rbp3	UTSW	14	33956627	missense	possibly damaging	0.93
R5837:Rbp3	UTSW	14	33954273	missense	probably benign	0.00
R5994:Rbp3	UTSW	14	33954900	missense	probably damaging	1.00
R6010:Rbp3	UTSW	14	33954647	missense	probably damaging	1.00
R6041:Rbp3	UTSW	14	33956482	missense	probably damaging	0.97
R6266:Rbp3	UTSW	14	33954461	missense	probably benign
R6357:Rbp3	UTSW	14	33957034	missense	probably damaging	0.99
R6457:Rbp3	UTSW	14	33955267	nonsense	probably null
R6777:Rbp3	UTSW	14	33954273	missense	probably benign	0.00
R7158:Rbp3	UTSW	14	33955556	missense	probably benign	0.00
R7183:Rbp3	UTSW	14	33955204	missense	probably benign	0.02
R7256:Rbp3	UTSW	14	33962583	missense	possibly damaging	0.93
R7654:Rbp3	UTSW	14	33955840	missense	probably benign
R7756:Rbp3	UTSW	14	33954775	missense	probably benign	0.15
R7758:Rbp3	UTSW	14	33954775	missense	probably benign	0.15
R7784:Rbp3	UTSW	14	33954158	missense	probably benign	0.41
R7845:Rbp3	UTSW	14	33956464	missense	probably benign	0.24
R8176:Rbp3	UTSW	14	33955648	missense	possibly damaging	0.67
R8281:Rbp3	UTSW	14	33956363	missense	probably benign	0.00
R8393:Rbp3	UTSW	14	33956199	missense	possibly damaging	0.93
Z1177:Rbp3	UTSW	14	33954538	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- ACAGCTGCCGAAGAGTTTGC -3'
(R):5'- TCCCCAGGGCTATGGAATAC -3'

Sequencing Primer
(F):5'- GAAGAGTTTGCCTTCCTCATGCAG -3'
(R):5'- TGGAATACCAGCAGGCGGTG -3'

Posted On

2014-12-04