Incidental Mutation 'R2504:Dzip1'
ID 252234
Institutional Source Beutler Lab
Gene Symbol Dzip1
Ensembl Gene ENSMUSG00000042156
Gene Name DAZ interacting protein 1
Synonyms 2510025K24Rik, 2810422M04Rik
MMRRC Submission 040412-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.447) question?
Stock # R2504 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 118875520-118925460 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 118881044 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 759 (T759K)
Ref Sequence ENSEMBL: ENSMUSP00000039689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004055] [ENSMUST00000047208]
AlphaFold Q8BMD2
Predicted Effect probably benign
Transcript: ENSMUST00000004055
AA Change: T759K

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000004055
Gene: ENSMUSG00000042156
AA Change: T759K

DomainStartEndE-ValueType
Pfam:Dzip-like_N 43 163 3.6e-45 PFAM
ZnF_C2H2 183 206 2.09e-3 SMART
coiled coil region 214 249 N/A INTRINSIC
coiled coil region 276 303 N/A INTRINSIC
coiled coil region 385 427 N/A INTRINSIC
low complexity region 451 463 N/A INTRINSIC
low complexity region 481 496 N/A INTRINSIC
low complexity region 661 673 N/A INTRINSIC
low complexity region 781 795 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047208
AA Change: T759K

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000039689
Gene: ENSMUSG00000042156
AA Change: T759K

DomainStartEndE-ValueType
Pfam:Dzip-like_N 43 163 3.7e-46 PFAM
ZnF_C2H2 183 206 2.09e-3 SMART
coiled coil region 214 249 N/A INTRINSIC
coiled coil region 276 303 N/A INTRINSIC
coiled coil region 385 427 N/A INTRINSIC
low complexity region 451 463 N/A INTRINSIC
low complexity region 481 496 N/A INTRINSIC
low complexity region 661 673 N/A INTRINSIC
low complexity region 781 795 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227344
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228157
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228861
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a zinc finger protein that has been demonstrated to interact with the deleted in azoospermia (DAZ) protein. DAZ plays an important role early in germ cell development to maintain the initial germ cell population. Deletion of this gene in mice compromises Hedgehog signaling during embryogenesis. Mouse embryos lacking the encoded protein show severe developmental defects with dorsalized neural tubes and underdeveloped somites. Alternative splicing of this gene results in multiple transcript variants. A pseudogene for this gene has been identified on chromosome 5. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a targeted allele lacking exons 2 and 3 exhibit partial embryonic lethality around E9.5, decreased embryo size, underdevelopment of the neural tube and somite and lack of primary cilia on MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,219,216 (GRCm38) E1750K probably damaging Het
4933425L06Rik A G 13: 105,109,742 (GRCm38) I270M probably benign Het
Aatk T C 11: 120,018,855 (GRCm38) D28G probably benign Het
Abcg1 T A 17: 31,092,395 (GRCm38) S125T probably damaging Het
Actbl2 T C 13: 111,256,183 (GRCm38) S351P possibly damaging Het
Ankrd34b A G 13: 92,439,061 (GRCm38) probably null Het
BC030867 T C 11: 102,255,296 (GRCm38) Y133H possibly damaging Het
BC051665 C T 13: 60,782,654 (GRCm38) V295I probably benign Het
C1qtnf2 A G 11: 43,491,156 (GRCm38) N265S probably damaging Het
Ccdc14 C T 16: 34,721,850 (GRCm38) R573* probably null Het
Cd55b A T 1: 130,409,875 (GRCm38) Y247N probably damaging Het
Celsr2 A T 3: 108,413,591 (GRCm38) V635E probably benign Het
Clec16a T C 16: 10,559,687 (GRCm38) probably benign Het
Clec4b1 A G 6: 123,065,945 (GRCm38) Y41C probably damaging Het
Cntn5 A T 9: 10,172,121 (GRCm38) D19E probably benign Het
Cop1 A G 1: 159,232,805 (GRCm38) N53S probably damaging Het
Csad A T 15: 102,188,667 (GRCm38) M1K probably null Het
Cyb5rl A G 4: 107,080,945 (GRCm38) I200V probably benign Het
Cyp26a1 A G 19: 37,698,342 (GRCm38) T81A probably damaging Het
Cyp2d12 A T 15: 82,559,036 (GRCm38) H433L probably benign Het
D7Ertd443e T A 7: 134,349,479 (GRCm38) probably null Het
Dennd1b A G 1: 139,170,170 (GRCm38) probably benign Het
Dmap1 G T 4: 117,675,298 (GRCm38) T357K probably damaging Het
Elmo2 A G 2: 165,298,687 (GRCm38) V300A probably damaging Het
Eml5 T C 12: 98,844,105 (GRCm38) D864G possibly damaging Het
Ep400 A G 5: 110,668,645 (GRCm38) V2670A probably damaging Het
Epha3 T A 16: 63,603,625 (GRCm38) I534F probably damaging Het
Epha4 A C 1: 77,382,991 (GRCm38) Y742D probably damaging Het
Ergic2 A G 6: 148,204,774 (GRCm38) probably null Het
Ero1l A T 14: 45,299,088 (GRCm38) probably null Het
Fam229a A G 4: 129,491,486 (GRCm38) D70G probably damaging Het
Fbn2 C T 18: 58,093,359 (GRCm38) R781Q probably damaging Het
Fbxo16 A T 14: 65,270,714 (GRCm38) probably benign Het
Fbxo39 T A 11: 72,317,285 (GRCm38) S154R probably benign Het
Fer T A 17: 63,991,580 (GRCm38) probably null Het
Filip1l A T 16: 57,571,047 (GRCm38) D428V probably damaging Het
Filip1l A G 16: 57,570,662 (GRCm38) I538V possibly damaging Het
Fsip2 T C 2: 82,979,610 (GRCm38) I2091T possibly damaging Het
Glyat A C 19: 12,651,398 (GRCm38) T186P possibly damaging Het
Gm10604 A G 4: 11,980,083 (GRCm38) S74P unknown Het
Gm4787 T G 12: 81,379,137 (GRCm38) K82N possibly damaging Het
Hectd4 T C 5: 121,220,620 (GRCm38) I50T unknown Het
Hectd4 T C 5: 121,263,967 (GRCm38) S373P possibly damaging Het
Hmcn1 A T 1: 150,686,867 (GRCm38) C2313* probably null Het
Igfn1 A T 1: 135,969,316 (GRCm38) S1171T probably benign Het
Ints8 T C 4: 11,241,642 (GRCm38) D267G probably benign Het
Itln1 A G 1: 171,529,159 (GRCm38) C251R probably damaging Het
Jcad C T 18: 4,674,026 (GRCm38) T596M probably damaging Het
Kcnj16 C T 11: 111,025,583 (GRCm38) T357M probably benign Het
Kif13a G A 13: 46,814,200 (GRCm38) T346M probably damaging Het
Klhl24 G A 16: 20,120,167 (GRCm38) A491T probably benign Het
Kntc1 C T 5: 123,778,347 (GRCm38) Q748* probably null Het
Krt25 T A 11: 99,317,296 (GRCm38) K369* probably null Het
Krt75 C T 15: 101,568,031 (GRCm38) R433Q probably benign Het
Krt76 A G 15: 101,884,858 (GRCm38) F582L unknown Het
Lysmd1 G A 3: 95,138,397 (GRCm38) V182I probably benign Het
Mab21l2 T A 3: 86,547,555 (GRCm38) E46V probably damaging Het
Magi2 A T 5: 20,358,936 (GRCm38) K355N probably damaging Het
March10 T C 11: 105,385,572 (GRCm38) D630G probably damaging Het
Mast4 A T 13: 102,738,639 (GRCm38) I1215N probably damaging Het
Nckap1 G A 2: 80,530,218 (GRCm38) T523I probably benign Het
Nexmif T A X: 104,084,393 (GRCm38) D1306V probably damaging Het
Nfkb1 A C 3: 135,589,329 (GRCm38) I918R possibly damaging Het
Nup50 A T 15: 84,933,658 (GRCm38) T93S probably benign Het
Nwd2 T C 5: 63,804,374 (GRCm38) Y434H probably benign Het
Olfr61 T C 7: 140,638,484 (GRCm38) V261A probably benign Het
Osbpl1a C A 18: 12,905,031 (GRCm38) V288L probably benign Het
Pan3 A G 5: 147,527,036 (GRCm38) E562G possibly damaging Het
Pappa T A 4: 65,180,889 (GRCm38) Y548* probably null Het
Phf3 A T 1: 30,810,789 (GRCm38) L1181Q probably damaging Het
Phip T C 9: 82,915,339 (GRCm38) H537R possibly damaging Het
Pkhd1l1 T C 15: 44,485,428 (GRCm38) I240T probably damaging Het
Pole G A 5: 110,290,502 (GRCm38) probably null Het
Polq T A 16: 37,011,942 (GRCm38) S15T unknown Het
Prrt2 T C 7: 127,020,224 (GRCm38) E23G possibly damaging Het
Prss37 A T 6: 40,517,826 (GRCm38) probably null Het
Prune2 T C 19: 17,000,036 (GRCm38) L45P probably damaging Het
Psd A T 19: 46,324,913 (GRCm38) M6K possibly damaging Het
Psmd1 A G 1: 86,089,997 (GRCm38) E510G possibly damaging Het
Ptch1 T G 13: 63,524,959 (GRCm38) E944A probably benign Het
Pxdn T A 12: 30,003,406 (GRCm38) I1194N probably damaging Het
Rbp3 C T 14: 33,956,018 (GRCm38) T641M probably damaging Het
Rgmb C A 17: 15,807,647 (GRCm38) R270L probably benign Het
Rpgrip1l A G 8: 91,280,716 (GRCm38) probably null Het
Rps2 G A 17: 24,720,379 (GRCm38) probably benign Het
Rsbn1l G T 5: 20,902,366 (GRCm38) A550E probably damaging Het
S1pr4 C T 10: 81,499,304 (GRCm38) R112H probably benign Het
Scfd2 T C 5: 74,531,177 (GRCm38) N148S probably damaging Het
Scin C T 12: 40,081,706 (GRCm38) M276I probably benign Het
Sec24d T C 3: 123,353,606 (GRCm38) I708T possibly damaging Het
Skint11 T A 4: 114,228,812 (GRCm38) F41I possibly damaging Het
Slc15a4 A T 5: 127,617,239 (GRCm38) F44Y possibly damaging Het
Slc6a18 A G 13: 73,675,806 (GRCm38) Y72H probably benign Het
Slc7a11 A T 3: 50,377,746 (GRCm38) probably null Het
Slc7a14 G T 3: 31,237,501 (GRCm38) N209K possibly damaging Het
Sstr2 T C 11: 113,624,431 (GRCm38) C59R probably damaging Het
Stab1 A G 14: 31,163,040 (GRCm38) probably null Het
Stag1 G T 9: 100,866,210 (GRCm38) S475I probably damaging Het
Stxbp5l A G 16: 37,115,667 (GRCm38) Y1183H probably damaging Het
Svep1 A T 4: 58,135,628 (GRCm38) probably null Het
Tm9sf2 A G 14: 122,158,684 (GRCm38) T653A probably benign Het
Tmeff1 T C 4: 48,662,059 (GRCm38) S366P possibly damaging Het
Tnnt2 G T 1: 135,852,065 (GRCm38) W300L probably damaging Het
Traj32 A G 14: 54,186,103 (GRCm38) probably benign Het
Trp53bp2 A T 1: 182,441,639 (GRCm38) M223L probably benign Het
Tsga10 G A 1: 37,815,677 (GRCm38) T246M probably damaging Het
Txn2 A T 15: 77,926,670 (GRCm38) probably benign Het
Ubr3 T A 2: 69,938,198 (GRCm38) F450I probably damaging Het
Usp47 T C 7: 112,104,470 (GRCm38) probably null Het
Vars2 C T 17: 35,664,793 (GRCm38) R244Q probably damaging Het
Xrra1 T A 7: 99,897,596 (GRCm38) F251L probably damaging Het
Zfp804a G A 2: 82,257,519 (GRCm38) R564Q probably benign Het
Zfp983 T C 17: 21,658,967 (GRCm38) C29R probably damaging Het
Other mutations in Dzip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Dzip1 APN 14 118,883,394 (GRCm38) missense probably benign 0.41
IGL01534:Dzip1 APN 14 118,877,239 (GRCm38) missense probably damaging 1.00
IGL01617:Dzip1 APN 14 118,881,065 (GRCm38) missense probably benign 0.16
IGL02537:Dzip1 APN 14 118,909,576 (GRCm38) splice site probably benign
IGL02801:Dzip1 APN 14 118,885,655 (GRCm38) nonsense probably null
IGL03354:Dzip1 APN 14 118,912,569 (GRCm38) splice site probably benign
BB003:Dzip1 UTSW 14 118,883,499 (GRCm38) missense probably benign 0.00
BB013:Dzip1 UTSW 14 118,883,499 (GRCm38) missense probably benign 0.00
PIT4151001:Dzip1 UTSW 14 118,922,788 (GRCm38) missense probably damaging 1.00
R0325:Dzip1 UTSW 14 118,909,557 (GRCm38) missense probably damaging 0.99
R0357:Dzip1 UTSW 14 118,909,538 (GRCm38) missense probably damaging 0.99
R0592:Dzip1 UTSW 14 118,902,139 (GRCm38) missense probably damaging 1.00
R0942:Dzip1 UTSW 14 118,887,197 (GRCm38) nonsense probably null
R1110:Dzip1 UTSW 14 118,889,305 (GRCm38) missense probably benign 0.15
R1458:Dzip1 UTSW 14 118,922,713 (GRCm38) missense probably benign 0.16
R1541:Dzip1 UTSW 14 118,879,478 (GRCm38) missense probably damaging 1.00
R2046:Dzip1 UTSW 14 118,922,478 (GRCm38) missense probably damaging 1.00
R2178:Dzip1 UTSW 14 118,889,404 (GRCm38) splice site probably null
R2316:Dzip1 UTSW 14 118,901,540 (GRCm38) missense probably benign 0.01
R2851:Dzip1 UTSW 14 118,922,445 (GRCm38) missense possibly damaging 0.71
R2852:Dzip1 UTSW 14 118,922,445 (GRCm38) missense possibly damaging 0.71
R3149:Dzip1 UTSW 14 118,911,368 (GRCm38) missense probably benign 0.38
R4111:Dzip1 UTSW 14 118,877,233 (GRCm38) nonsense probably null
R4349:Dzip1 UTSW 14 118,883,526 (GRCm38) missense probably benign 0.00
R4350:Dzip1 UTSW 14 118,883,526 (GRCm38) missense probably benign 0.00
R4351:Dzip1 UTSW 14 118,883,526 (GRCm38) missense probably benign 0.00
R4352:Dzip1 UTSW 14 118,883,526 (GRCm38) missense probably benign 0.00
R4868:Dzip1 UTSW 14 118,877,214 (GRCm38) missense probably damaging 1.00
R5172:Dzip1 UTSW 14 118,887,151 (GRCm38) missense probably damaging 0.97
R5191:Dzip1 UTSW 14 118,911,393 (GRCm38) missense probably damaging 1.00
R5192:Dzip1 UTSW 14 118,911,393 (GRCm38) missense probably damaging 1.00
R5376:Dzip1 UTSW 14 118,911,393 (GRCm38) missense probably damaging 1.00
R5378:Dzip1 UTSW 14 118,911,393 (GRCm38) missense probably damaging 1.00
R5655:Dzip1 UTSW 14 118,887,232 (GRCm38) critical splice acceptor site probably null
R5816:Dzip1 UTSW 14 118,909,480 (GRCm38) missense probably benign 0.00
R7256:Dzip1 UTSW 14 118,885,646 (GRCm38) missense probably benign 0.00
R7768:Dzip1 UTSW 14 118,879,498 (GRCm38) missense probably benign 0.11
R7788:Dzip1 UTSW 14 118,883,393 (GRCm38) missense probably benign 0.00
R7926:Dzip1 UTSW 14 118,883,499 (GRCm38) missense probably benign 0.00
R8477:Dzip1 UTSW 14 118,901,546 (GRCm38) missense possibly damaging 0.80
R8816:Dzip1 UTSW 14 118,922,373 (GRCm38) missense probably benign
R8933:Dzip1 UTSW 14 118,906,914 (GRCm38) missense probably damaging 0.98
R9233:Dzip1 UTSW 14 118,887,223 (GRCm38) missense probably benign
R9458:Dzip1 UTSW 14 118,911,373 (GRCm38) missense probably damaging 0.96
R9781:Dzip1 UTSW 14 118,911,422 (GRCm38) missense probably benign 0.35
X0009:Dzip1 UTSW 14 118,877,214 (GRCm38) missense probably damaging 0.98
X0026:Dzip1 UTSW 14 118,922,457 (GRCm38) missense probably damaging 1.00
Z1177:Dzip1 UTSW 14 118,911,376 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTCTACCTACAGAACCGAACTG -3'
(R):5'- GTTGTGTGTAAAGCTGAGACTCC -3'

Sequencing Primer
(F):5'- CTACAGAACCGAACTGTGAAAAG -3'
(R):5'- TGTGTAAAGCTGAGACTCCTTTAG -3'
Posted On 2014-12-04