Incidental Mutation 'R2504:Polq'
ID 252259
Institutional Source Beutler Lab
Gene Symbol Polq
Ensembl Gene ENSMUSG00000034206
Gene Name polymerase (DNA directed), theta
Synonyms A430110D14Rik
MMRRC Submission 040412-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.492) question?
Stock # R2504 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 36832148-36915779 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 36832304 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 15 (S15T)
Ref Sequence ENSEMBL: ENSMUSP00000138648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054034] [ENSMUST00000071452] [ENSMUST00000182946] [ENSMUST00000183112]
AlphaFold Q8CGS6
Predicted Effect unknown
Transcript: ENSMUST00000054034
AA Change: S15T
SMART Domains Protein: ENSMUSP00000059757
Gene: ENSMUSG00000034206
AA Change: S15T

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
DEXDc 87 298 4.09e-18 SMART
HELICc 398 484 4.02e-17 SMART
Blast:DEXDc 485 550 2e-25 BLAST
low complexity region 609 626 N/A INTRINSIC
PDB:2ZJA|A 712 826 5e-9 PDB
low complexity region 845 852 N/A INTRINSIC
low complexity region 898 911 N/A INTRINSIC
low complexity region 1126 1149 N/A INTRINSIC
low complexity region 1813 1822 N/A INTRINSIC
POLAc 2265 2504 3.3e-101 SMART
low complexity region 2521 2531 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000071452
AA Change: S15T
SMART Domains Protein: ENSMUSP00000071396
Gene: ENSMUSG00000034206
AA Change: S15T

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 216 5.9e-12 PFAM
low complexity region 330 347 N/A INTRINSIC
PDB:2ZJA|A 433 547 5e-9 PDB
low complexity region 566 573 N/A INTRINSIC
low complexity region 619 632 N/A INTRINSIC
low complexity region 847 870 N/A INTRINSIC
low complexity region 1534 1543 N/A INTRINSIC
POLAc 1986 2225 3.3e-101 SMART
low complexity region 2242 2252 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182163
Predicted Effect unknown
Transcript: ENSMUST00000182946
AA Change: S15T
SMART Domains Protein: ENSMUSP00000138685
Gene: ENSMUSG00000034206
AA Change: S15T

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 164 1.3e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000183112
AA Change: S15T
SMART Domains Protein: ENSMUSP00000138648
Gene: ENSMUSG00000034206
AA Change: S15T

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 164 1.3e-9 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Animals carrying a homozygous mutation at this locus display elevated levels of chromosomal damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk T C 11: 119,909,681 (GRCm39) D28G probably benign Het
Abcg1 T A 17: 31,311,369 (GRCm39) S125T probably damaging Het
Actbl2 T C 13: 111,392,717 (GRCm39) S351P possibly damaging Het
Ankrd34b A G 13: 92,575,569 (GRCm39) probably null Het
BC051665 C T 13: 60,930,468 (GRCm39) V295I probably benign Het
C1qtnf2 A G 11: 43,381,983 (GRCm39) N265S probably damaging Het
Ccdc14 C T 16: 34,542,220 (GRCm39) R573* probably null Het
Cd55b A T 1: 130,337,612 (GRCm39) Y247N probably damaging Het
Celsr2 A T 3: 108,320,907 (GRCm39) V635E probably benign Het
Clec16a T C 16: 10,377,551 (GRCm39) probably benign Het
Clec4b1 A G 6: 123,042,904 (GRCm39) Y41C probably damaging Het
Cntn5 A T 9: 10,172,126 (GRCm39) D19E probably benign Het
Cop1 A G 1: 159,060,375 (GRCm39) N53S probably damaging Het
Cplane1 G A 15: 8,248,700 (GRCm39) E1750K probably damaging Het
Csad A T 15: 102,097,102 (GRCm39) M1K probably null Het
Cyb5rl A G 4: 106,938,142 (GRCm39) I200V probably benign Het
Cyp26a1 A G 19: 37,686,790 (GRCm39) T81A probably damaging Het
Cyp2d12 A T 15: 82,443,237 (GRCm39) H433L probably benign Het
D7Ertd443e T A 7: 133,951,208 (GRCm39) probably null Het
Dennd1b A G 1: 139,097,908 (GRCm39) probably benign Het
Dmap1 G T 4: 117,532,495 (GRCm39) T357K probably damaging Het
Dzip1 G T 14: 119,118,456 (GRCm39) T759K probably benign Het
Elmo2 A G 2: 165,140,607 (GRCm39) V300A probably damaging Het
Eml5 T C 12: 98,810,364 (GRCm39) D864G possibly damaging Het
Ep400 A G 5: 110,816,511 (GRCm39) V2670A probably damaging Het
Epha3 T A 16: 63,423,988 (GRCm39) I534F probably damaging Het
Epha4 A C 1: 77,359,628 (GRCm39) Y742D probably damaging Het
Ergic2 A G 6: 148,106,272 (GRCm39) probably null Het
Ero1a A T 14: 45,536,545 (GRCm39) probably null Het
Fam229a A G 4: 129,385,279 (GRCm39) D70G probably damaging Het
Fbn2 C T 18: 58,226,431 (GRCm39) R781Q probably damaging Het
Fbxo16 A T 14: 65,508,163 (GRCm39) probably benign Het
Fbxo39 T A 11: 72,208,111 (GRCm39) S154R probably benign Het
Fer T A 17: 64,298,575 (GRCm39) probably null Het
Filip1l A T 16: 57,391,410 (GRCm39) D428V probably damaging Het
Filip1l A G 16: 57,391,025 (GRCm39) I538V possibly damaging Het
Fsip2 T C 2: 82,809,954 (GRCm39) I2091T possibly damaging Het
Glyat A C 19: 12,628,762 (GRCm39) T186P possibly damaging Het
Gm10604 A G 4: 11,980,083 (GRCm39) S74P unknown Het
Gm4787 T G 12: 81,425,911 (GRCm39) K82N possibly damaging Het
Hectd4 T C 5: 121,358,683 (GRCm39) I50T unknown Het
Hectd4 T C 5: 121,402,030 (GRCm39) S373P possibly damaging Het
Hmcn1 A T 1: 150,562,618 (GRCm39) C2313* probably null Het
Hrob T C 11: 102,146,122 (GRCm39) Y133H possibly damaging Het
Igfn1 A T 1: 135,897,054 (GRCm39) S1171T probably benign Het
Ints8 T C 4: 11,241,642 (GRCm39) D267G probably benign Het
Itln1 A G 1: 171,356,727 (GRCm39) C251R probably damaging Het
Jcad C T 18: 4,674,026 (GRCm39) T596M probably damaging Het
Kcnj16 C T 11: 110,916,409 (GRCm39) T357M probably benign Het
Kif13a G A 13: 46,967,676 (GRCm39) T346M probably damaging Het
Klhl24 G A 16: 19,938,917 (GRCm39) A491T probably benign Het
Kntc1 C T 5: 123,916,410 (GRCm39) Q748* probably null Het
Krt25 T A 11: 99,208,122 (GRCm39) K369* probably null Het
Krt75 C T 15: 101,476,466 (GRCm39) R433Q probably benign Het
Krt76 A G 15: 101,793,293 (GRCm39) F582L unknown Het
Lysmd1 G A 3: 95,045,708 (GRCm39) V182I probably benign Het
Mab21l2 T A 3: 86,454,862 (GRCm39) E46V probably damaging Het
Magi2 A T 5: 20,563,934 (GRCm39) K355N probably damaging Het
Marchf10 T C 11: 105,276,398 (GRCm39) D630G probably damaging Het
Mast4 A T 13: 102,875,147 (GRCm39) I1215N probably damaging Het
Nckap1 G A 2: 80,360,562 (GRCm39) T523I probably benign Het
Nexmif T A X: 103,127,999 (GRCm39) D1306V probably damaging Het
Nfkb1 A C 3: 135,295,090 (GRCm39) I918R possibly damaging Het
Nt5el A G 13: 105,246,250 (GRCm39) I270M probably benign Het
Nup50 A T 15: 84,817,859 (GRCm39) T93S probably benign Het
Nwd2 T C 5: 63,961,717 (GRCm39) Y434H probably benign Het
Or13a28 T C 7: 140,218,397 (GRCm39) V261A probably benign Het
Osbpl1a C A 18: 13,038,088 (GRCm39) V288L probably benign Het
Pan3 A G 5: 147,463,846 (GRCm39) E562G possibly damaging Het
Pappa T A 4: 65,099,126 (GRCm39) Y548* probably null Het
Phf3 A T 1: 30,849,870 (GRCm39) L1181Q probably damaging Het
Phip T C 9: 82,797,392 (GRCm39) H537R possibly damaging Het
Pkhd1l1 T C 15: 44,348,824 (GRCm39) I240T probably damaging Het
Pole G A 5: 110,438,368 (GRCm39) probably null Het
Prrt2 T C 7: 126,619,396 (GRCm39) E23G possibly damaging Het
Prss37 A T 6: 40,494,760 (GRCm39) probably null Het
Prune2 T C 19: 16,977,400 (GRCm39) L45P probably damaging Het
Psd A T 19: 46,313,352 (GRCm39) M6K possibly damaging Het
Psmd1 A G 1: 86,017,719 (GRCm39) E510G possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Pxdn T A 12: 30,053,405 (GRCm39) I1194N probably damaging Het
Rbp3 C T 14: 33,677,975 (GRCm39) T641M probably damaging Het
Rgmb C A 17: 16,027,909 (GRCm39) R270L probably benign Het
Rpgrip1l A G 8: 92,007,344 (GRCm39) probably null Het
Rps2 G A 17: 24,939,353 (GRCm39) probably benign Het
Rsbn1l G T 5: 21,107,364 (GRCm39) A550E probably damaging Het
S1pr4 C T 10: 81,335,138 (GRCm39) R112H probably benign Het
Scfd2 T C 5: 74,691,838 (GRCm39) N148S probably damaging Het
Scin C T 12: 40,131,705 (GRCm39) M276I probably benign Het
Sec24d T C 3: 123,147,255 (GRCm39) I708T possibly damaging Het
Skint11 T A 4: 114,086,009 (GRCm39) F41I possibly damaging Het
Slc15a4 A T 5: 127,694,303 (GRCm39) F44Y possibly damaging Het
Slc6a18 A G 13: 73,823,925 (GRCm39) Y72H probably benign Het
Slc7a11 A T 3: 50,332,195 (GRCm39) probably null Het
Slc7a14 G T 3: 31,291,650 (GRCm39) N209K possibly damaging Het
Sstr2 T C 11: 113,515,257 (GRCm39) C59R probably damaging Het
Stab1 A G 14: 30,884,997 (GRCm39) probably null Het
Stag1 G T 9: 100,748,263 (GRCm39) S475I probably damaging Het
Stxbp5l A G 16: 36,936,029 (GRCm39) Y1183H probably damaging Het
Svep1 A T 4: 58,135,628 (GRCm39) probably null Het
Tm9sf2 A G 14: 122,396,096 (GRCm39) T653A probably benign Het
Tmeff1 T C 4: 48,662,059 (GRCm39) S366P possibly damaging Het
Tnnt2 G T 1: 135,779,803 (GRCm39) W300L probably damaging Het
Traj32 A G 14: 54,423,560 (GRCm39) probably benign Het
Trp53bp2 A T 1: 182,269,204 (GRCm39) M223L probably benign Het
Tsga10 G A 1: 37,854,758 (GRCm39) T246M probably damaging Het
Txn2 A T 15: 77,810,870 (GRCm39) probably benign Het
Ubr3 T A 2: 69,768,542 (GRCm39) F450I probably damaging Het
Usp47 T C 7: 111,703,677 (GRCm39) probably null Het
Vars2 C T 17: 35,975,685 (GRCm39) R244Q probably damaging Het
Xrra1 T A 7: 99,546,803 (GRCm39) F251L probably damaging Het
Zfp804a G A 2: 82,087,863 (GRCm39) R564Q probably benign Het
Zfp983 T C 17: 21,877,883 (GRCm39) C29R probably damaging Het
Other mutations in Polq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Polq APN 16 36,885,609 (GRCm39) splice site probably benign
IGL00539:Polq APN 16 36,880,931 (GRCm39) missense probably damaging 0.98
IGL00960:Polq APN 16 36,880,874 (GRCm39) missense probably damaging 0.96
IGL01100:Polq APN 16 36,881,474 (GRCm39) missense probably benign
IGL01112:Polq APN 16 36,837,671 (GRCm39) missense probably damaging 1.00
IGL01138:Polq APN 16 36,866,231 (GRCm39) missense possibly damaging 0.94
IGL01432:Polq APN 16 36,892,184 (GRCm39) splice site probably benign
IGL01522:Polq APN 16 36,848,265 (GRCm39) missense probably damaging 1.00
IGL01565:Polq APN 16 36,833,475 (GRCm39) missense probably benign 0.00
IGL01592:Polq APN 16 36,855,212 (GRCm39) missense probably benign 0.01
IGL01690:Polq APN 16 36,883,200 (GRCm39) missense probably damaging 0.97
IGL01943:Polq APN 16 36,881,805 (GRCm39) missense possibly damaging 0.47
IGL02531:Polq APN 16 36,882,736 (GRCm39) missense possibly damaging 0.75
IGL02553:Polq APN 16 36,862,130 (GRCm39) missense probably damaging 1.00
IGL02623:Polq APN 16 36,880,737 (GRCm39) missense probably benign 0.04
IGL02692:Polq APN 16 36,880,989 (GRCm39) missense probably damaging 1.00
IGL02717:Polq APN 16 36,843,102 (GRCm39) missense probably damaging 1.00
IGL02937:Polq APN 16 36,833,471 (GRCm39) missense probably benign 0.14
IGL02959:Polq APN 16 36,906,928 (GRCm39) missense probably damaging 1.00
IGL03086:Polq APN 16 36,911,411 (GRCm39) missense probably benign 0.02
IGL03141:Polq APN 16 36,837,720 (GRCm39) splice site probably benign
IGL03302:Polq APN 16 36,892,134 (GRCm39) missense probably damaging 1.00
IGL03393:Polq APN 16 36,865,156 (GRCm39) missense probably damaging 1.00
R0013_Polq_667 UTSW 16 36,882,201 (GRCm39) missense possibly damaging 0.56
R4238_Polq_233 UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4280_polq_867 UTSW 16 36,902,419 (GRCm39) missense probably damaging 1.00
G1Funyon:Polq UTSW 16 36,882,181 (GRCm39) missense probably damaging 1.00
PIT4403001:Polq UTSW 16 36,880,949 (GRCm39) missense probably benign 0.00
R0013:Polq UTSW 16 36,882,201 (GRCm39) missense possibly damaging 0.56
R0082:Polq UTSW 16 36,837,619 (GRCm39) missense probably benign 0.01
R0212:Polq UTSW 16 36,887,216 (GRCm39) missense probably damaging 0.99
R0387:Polq UTSW 16 36,909,679 (GRCm39) missense probably damaging 1.00
R0387:Polq UTSW 16 36,849,792 (GRCm39) missense probably damaging 1.00
R0427:Polq UTSW 16 36,882,355 (GRCm39) nonsense probably null
R0454:Polq UTSW 16 36,855,252 (GRCm39) missense probably damaging 0.98
R0513:Polq UTSW 16 36,914,864 (GRCm39) missense probably damaging 1.00
R0622:Polq UTSW 16 36,881,355 (GRCm39) missense probably benign 0.02
R0848:Polq UTSW 16 36,882,492 (GRCm39) missense probably benign 0.08
R1142:Polq UTSW 16 36,833,579 (GRCm39) missense probably damaging 0.98
R1218:Polq UTSW 16 36,849,808 (GRCm39) missense possibly damaging 0.93
R1331:Polq UTSW 16 36,862,109 (GRCm39) missense probably damaging 1.00
R1398:Polq UTSW 16 36,882,857 (GRCm39) missense possibly damaging 0.87
R1424:Polq UTSW 16 36,906,890 (GRCm39) missense probably damaging 1.00
R1644:Polq UTSW 16 36,880,626 (GRCm39) missense probably damaging 0.96
R1777:Polq UTSW 16 36,880,586 (GRCm39) missense possibly damaging 0.94
R1820:Polq UTSW 16 36,849,780 (GRCm39) missense possibly damaging 0.48
R1854:Polq UTSW 16 36,882,471 (GRCm39) missense probably benign 0.01
R1880:Polq UTSW 16 36,906,954 (GRCm39) missense possibly damaging 0.90
R1932:Polq UTSW 16 36,882,666 (GRCm39) missense possibly damaging 0.92
R2008:Polq UTSW 16 36,882,844 (GRCm39) missense probably damaging 0.96
R2014:Polq UTSW 16 36,898,728 (GRCm39) missense probably damaging 1.00
R2026:Polq UTSW 16 36,883,107 (GRCm39) missense possibly damaging 0.93
R2178:Polq UTSW 16 36,883,191 (GRCm39) missense probably damaging 1.00
R2259:Polq UTSW 16 36,882,459 (GRCm39) missense probably benign 0.03
R2266:Polq UTSW 16 36,882,515 (GRCm39) missense possibly damaging 0.59
R2305:Polq UTSW 16 36,882,699 (GRCm39) missense probably damaging 0.99
R2370:Polq UTSW 16 36,894,301 (GRCm39) missense probably damaging 1.00
R2517:Polq UTSW 16 36,909,687 (GRCm39) missense probably damaging 1.00
R2697:Polq UTSW 16 36,862,515 (GRCm39) missense probably damaging 1.00
R2858:Polq UTSW 16 36,883,115 (GRCm39) missense possibly damaging 0.88
R3436:Polq UTSW 16 36,882,699 (GRCm39) missense probably damaging 0.99
R3437:Polq UTSW 16 36,882,699 (GRCm39) missense probably damaging 0.99
R3699:Polq UTSW 16 36,862,518 (GRCm39) missense probably damaging 1.00
R3838:Polq UTSW 16 36,898,711 (GRCm39) missense probably damaging 1.00
R3875:Polq UTSW 16 36,894,389 (GRCm39) missense probably damaging 0.99
R4050:Polq UTSW 16 36,913,182 (GRCm39) critical splice acceptor site probably null
R4172:Polq UTSW 16 36,881,120 (GRCm39) missense probably benign 0.02
R4238:Polq UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4240:Polq UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4280:Polq UTSW 16 36,902,419 (GRCm39) missense probably damaging 1.00
R4296:Polq UTSW 16 36,881,663 (GRCm39) missense possibly damaging 0.94
R4360:Polq UTSW 16 36,880,701 (GRCm39) missense probably benign 0.00
R4373:Polq UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4375:Polq UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4376:Polq UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4509:Polq UTSW 16 36,868,925 (GRCm39) missense probably damaging 1.00
R4510:Polq UTSW 16 36,868,925 (GRCm39) missense probably damaging 1.00
R4511:Polq UTSW 16 36,868,925 (GRCm39) missense probably damaging 1.00
R4543:Polq UTSW 16 36,881,147 (GRCm39) missense probably benign 0.43
R4633:Polq UTSW 16 36,868,904 (GRCm39) missense probably damaging 1.00
R4739:Polq UTSW 16 36,862,109 (GRCm39) missense probably damaging 1.00
R4834:Polq UTSW 16 36,848,176 (GRCm39) missense probably damaging 1.00
R4841:Polq UTSW 16 36,869,145 (GRCm39) critical splice donor site probably null
R4842:Polq UTSW 16 36,869,145 (GRCm39) critical splice donor site probably null
R4937:Polq UTSW 16 36,848,274 (GRCm39) missense probably benign 0.01
R4955:Polq UTSW 16 36,881,444 (GRCm39) missense probably benign 0.32
R4992:Polq UTSW 16 36,881,524 (GRCm39) missense possibly damaging 0.59
R5008:Polq UTSW 16 36,882,749 (GRCm39) missense probably benign
R5221:Polq UTSW 16 36,862,540 (GRCm39) missense probably damaging 0.98
R5254:Polq UTSW 16 36,909,681 (GRCm39) missense probably damaging 1.00
R5292:Polq UTSW 16 36,881,745 (GRCm39) missense probably damaging 1.00
R5375:Polq UTSW 16 36,903,146 (GRCm39) missense probably damaging 1.00
R5480:Polq UTSW 16 36,833,652 (GRCm39) splice site probably benign
R5552:Polq UTSW 16 36,914,872 (GRCm39) missense possibly damaging 0.93
R5591:Polq UTSW 16 36,832,247 (GRCm39) utr 5 prime probably benign
R5653:Polq UTSW 16 36,860,896 (GRCm39) missense probably damaging 1.00
R5708:Polq UTSW 16 36,881,380 (GRCm39) missense probably damaging 0.98
R5754:Polq UTSW 16 36,837,625 (GRCm39) missense probably benign
R5757:Polq UTSW 16 36,907,043 (GRCm39) missense probably benign 0.01
R5764:Polq UTSW 16 36,837,706 (GRCm39) missense probably damaging 0.97
R6019:Polq UTSW 16 36,882,126 (GRCm39) missense probably damaging 1.00
R6170:Polq UTSW 16 36,866,174 (GRCm39) missense possibly damaging 0.82
R6177:Polq UTSW 16 36,892,071 (GRCm39) missense probably damaging 0.98
R6307:Polq UTSW 16 36,837,718 (GRCm39) critical splice donor site probably null
R6499:Polq UTSW 16 36,881,189 (GRCm39) missense probably benign 0.03
R6520:Polq UTSW 16 36,880,739 (GRCm39) missense possibly damaging 0.88
R6598:Polq UTSW 16 36,881,993 (GRCm39) missense probably benign 0.39
R6694:Polq UTSW 16 36,835,535 (GRCm39) missense probably null 0.99
R6788:Polq UTSW 16 36,897,510 (GRCm39) missense probably damaging 1.00
R7104:Polq UTSW 16 36,909,715 (GRCm39) nonsense probably null
R7159:Polq UTSW 16 36,883,215 (GRCm39) missense possibly damaging 0.87
R7222:Polq UTSW 16 36,906,995 (GRCm39) nonsense probably null
R7340:Polq UTSW 16 36,881,288 (GRCm39) missense probably benign 0.00
R7361:Polq UTSW 16 36,880,790 (GRCm39) missense probably benign 0.00
R7384:Polq UTSW 16 36,849,780 (GRCm39) missense probably damaging 1.00
R7509:Polq UTSW 16 36,880,706 (GRCm39) missense probably benign 0.00
R7509:Polq UTSW 16 36,880,705 (GRCm39) missense probably benign
R7575:Polq UTSW 16 36,911,496 (GRCm39) missense probably benign 0.00
R7785:Polq UTSW 16 36,848,239 (GRCm39) missense probably damaging 1.00
R7787:Polq UTSW 16 36,837,671 (GRCm39) missense probably damaging 1.00
R7891:Polq UTSW 16 36,848,244 (GRCm39) missense probably damaging 1.00
R7898:Polq UTSW 16 36,865,245 (GRCm39) missense probably damaging 0.98
R7917:Polq UTSW 16 36,885,650 (GRCm39) missense probably benign 0.08
R7940:Polq UTSW 16 36,881,004 (GRCm39) missense probably benign 0.27
R8028:Polq UTSW 16 36,881,678 (GRCm39) missense possibly damaging 0.82
R8114:Polq UTSW 16 36,862,577 (GRCm39) missense possibly damaging 0.94
R8144:Polq UTSW 16 36,849,846 (GRCm39) missense probably benign 0.01
R8288:Polq UTSW 16 36,848,272 (GRCm39) missense probably damaging 1.00
R8301:Polq UTSW 16 36,882,181 (GRCm39) missense probably damaging 1.00
R8341:Polq UTSW 16 36,892,133 (GRCm39) missense possibly damaging 0.96
R8348:Polq UTSW 16 36,837,559 (GRCm39) critical splice acceptor site probably null
R8448:Polq UTSW 16 36,837,559 (GRCm39) critical splice acceptor site probably null
R8815:Polq UTSW 16 36,853,893 (GRCm39) missense probably damaging 1.00
R8843:Polq UTSW 16 36,832,280 (GRCm39) missense unknown
R8878:Polq UTSW 16 36,860,869 (GRCm39) missense probably benign 0.02
R9016:Polq UTSW 16 36,843,159 (GRCm39) missense probably damaging 1.00
R9189:Polq UTSW 16 36,865,265 (GRCm39) missense probably damaging 1.00
R9209:Polq UTSW 16 36,869,011 (GRCm39) missense possibly damaging 0.94
R9352:Polq UTSW 16 36,862,252 (GRCm39) missense probably damaging 0.98
R9398:Polq UTSW 16 36,881,394 (GRCm39) missense probably benign 0.02
R9403:Polq UTSW 16 36,882,215 (GRCm39) missense probably benign 0.00
R9489:Polq UTSW 16 36,843,173 (GRCm39) missense probably benign 0.00
R9605:Polq UTSW 16 36,843,173 (GRCm39) missense probably benign 0.00
R9664:Polq UTSW 16 36,848,176 (GRCm39) missense probably damaging 0.98
R9801:Polq UTSW 16 36,913,190 (GRCm39) missense probably damaging 1.00
X0060:Polq UTSW 16 36,837,599 (GRCm39) nonsense probably null
Z1176:Polq UTSW 16 36,862,619 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TAGCCAGGAGAACTCTGTGG -3'
(R):5'- AGTGCATGGCCCTGATACTC -3'

Sequencing Primer
(F):5'- CAGGAGAACTCTGTGGTTCCG -3'
(R):5'- ATGGCCCTGATACTCTCGCAG -3'
Posted On 2014-12-04