Incidental Mutation 'R0311:Hexb'
ID25226
Institutional Source Beutler Lab
Gene Symbol Hexb
Ensembl Gene ENSMUSG00000021665
Gene Namehexosaminidase B
Synonyms
MMRRC Submission 038521-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0311 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location97176331-97198357 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 97183819 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022169] [ENSMUST00000161825]
Predicted Effect probably benign
Transcript: ENSMUST00000022169
SMART Domains Protein: ENSMUSP00000022169
Gene: ENSMUSG00000021665

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:Glycohydro_20b2 35 157 7.1e-24 PFAM
Pfam:Glyco_hydro_20 179 496 1.2e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161825
SMART Domains Protein: ENSMUSP00000125088
Gene: ENSMUSG00000021666

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 351 2.3e-64 PFAM
Pfam:GTP_EFTU_D2 381 448 1.1e-8 PFAM
low complexity region 449 475 N/A INTRINSIC
Pfam:EFG_II 484 558 7.1e-30 PFAM
EFG_IV 560 679 2.94e-17 SMART
EFG_C 681 738 3.46e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222700
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.6%
  • 20x: 91.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hexosaminidase B is the beta subunit of the lysosomal enzyme beta-hexosaminidase that, together with the cofactor GM2 activator protein, catalyzes the degradation of the ganglioside GM2, and other molecules containing terminal N-acetyl hexosamines. Beta-hexosaminidase is composed of two subunits, alpha and beta, which are encoded by separate genes. Both beta-hexosaminidase alpha and beta subunits are members of family 20 of glycosyl hydrolases. Mutations in the alpha or beta subunit genes lead to an accumulation of GM2 ganglioside in neurons and neurodegenerative disorders termed the GM2 gangliosidoses. Beta subunit gene mutations lead to Sandhoff disease (GM2-gangliosidosis type II). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous mutants exhibit spasticity, muscle weakness, rigidity, tremors, and ataxia beginning around 4 months of age and resulting in death about 6 weeks later. Mutants accumulate GM2 ganglioside and glycolipid GA2 in brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A C 7: 120,402,904 M1547L probably damaging Het
Abcb4 A G 5: 8,934,243 K658E probably benign Het
Abr A G 11: 76,509,127 S15P possibly damaging Het
Adgrb2 G C 4: 130,017,129 A1168P probably damaging Het
Adgre4 A T 17: 55,802,010 E339V probably benign Het
Asprv1 T C 6: 86,628,840 W223R probably damaging Het
Ccdc89 A G 7: 90,426,693 E37G probably damaging Het
Cd48 C A 1: 171,699,580 Y191* probably null Het
Chd4 T C 6: 125,101,665 I257T probably benign Het
Clca4b T C 3: 144,932,496 M2V probably benign Het
Dnah11 A T 12: 118,127,133 D1025E probably benign Het
Erich5 A G 15: 34,472,939 *363W probably null Het
Etl4 A G 2: 20,807,129 D1341G probably damaging Het
Fbxw11 A G 11: 32,722,083 T184A probably benign Het
Fktn A G 4: 53,744,620 Q300R probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gdpd3 G A 7: 126,767,189 R66Q possibly damaging Het
Kdm4b A G 17: 56,386,200 R346G probably benign Het
Mbtd1 T A 11: 93,921,357 probably null Het
Med23 T A 10: 24,897,358 C653S possibly damaging Het
Nwd2 A T 5: 63,804,998 I642L probably damaging Het
Olfr1444 A G 19: 12,861,869 I31M probably benign Het
Olfr1448 T A 19: 12,920,096 Y71F possibly damaging Het
Olfr912 T C 9: 38,539,297 V134A probably benign Het
Pbld2 T C 10: 63,054,507 probably null Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Plpp2 C T 10: 79,527,580 R77K probably damaging Het
Pym1 G T 10: 128,765,984 R168L possibly damaging Het
Rbm4 T C 19: 4,787,556 Y300C probably damaging Het
Rnf207 A G 4: 152,315,779 C175R probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Speg T C 1: 75,430,937 V3196A probably damaging Het
Syne1 T A 10: 5,348,943 I1048L possibly damaging Het
Th T C 7: 142,896,041 E41G probably damaging Het
Tmx4 T A 2: 134,598,526 *336L probably null Het
Tnfrsf18 T C 4: 156,026,415 V10A possibly damaging Het
Tnxb A T 17: 34,716,984 I2670F probably damaging Het
Tpx2 T C 2: 152,890,492 V562A probably damaging Het
Vmn2r73 A G 7: 85,871,789 S324P probably benign Het
Vps18 T C 2: 119,297,365 Y890H probably benign Het
Ythdc1 G A 5: 86,835,705 D670N probably damaging Het
Other mutations in Hexb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Hexb APN 13 97181929 missense probably damaging 1.00
IGL02010:Hexb APN 13 97176845 missense probably benign 0.01
IGL02126:Hexb APN 13 97178024 missense possibly damaging 0.93
IGL02303:Hexb APN 13 97176893 missense probably damaging 1.00
IGL02955:Hexb APN 13 97181076 utr 3 prime probably benign
IGL02988:Hexb UTSW 13 97198221 missense unknown
R0470:Hexb UTSW 13 97177999 missense probably damaging 0.97
R0520:Hexb UTSW 13 97181110 missense probably benign 0.00
R0893:Hexb UTSW 13 97185627 missense probably benign 0.02
R1869:Hexb UTSW 13 97191259 missense probably benign
R2295:Hexb UTSW 13 97185612 missense probably damaging 1.00
R2884:Hexb UTSW 13 97183700 missense probably damaging 1.00
R4237:Hexb UTSW 13 97176751 intron probably benign
R4238:Hexb UTSW 13 97176751 intron probably benign
R4239:Hexb UTSW 13 97176751 intron probably benign
R4689:Hexb UTSW 13 97181092 missense probably damaging 1.00
R5166:Hexb UTSW 13 97182004 missense probably benign 0.13
R6665:Hexb UTSW 13 97179385 missense probably benign 0.01
R7379:Hexb UTSW 13 97181164 missense probably damaging 1.00
R7553:Hexb UTSW 13 97198173 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCCCAAAGTGTGTCAGCCAATAAC -3'
(R):5'- TGAGAGTCCCCTCAGTGAATCCTG -3'

Sequencing Primer
(F):5'- GGAACTAAGTCATCATGTGCTCC -3'
(R):5'- GAATTCAACGGGCAGAAATTCAC -3'
Posted On2013-04-16