Incidental Mutation 'R2852:Map4k4'
ID252275
Institutional Source Beutler Lab
Gene Symbol Map4k4
Ensembl Gene ENSMUSG00000026074
Gene Namemitogen-activated protein kinase kinase kinase kinase 4
Synonyms9430080K19Rik, Nik
MMRRC Submission 040445-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2852 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location39900913-40026310 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 40000755 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163854] [ENSMUST00000168431] [ENSMUST00000191964] [ENSMUST00000192509] [ENSMUST00000193682] [ENSMUST00000195259] [ENSMUST00000195636] [ENSMUST00000195860]
Predicted Effect probably benign
Transcript: ENSMUST00000163854
SMART Domains Protein: ENSMUSP00000126961
Gene: ENSMUSG00000026074

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 721 747 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 811 837 N/A INTRINSIC
low complexity region 891 904 N/A INTRINSIC
low complexity region 919 929 N/A INTRINSIC
CNH 970 1268 2.76e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168431
SMART Domains Protein: ENSMUSP00000129796
Gene: ENSMUSG00000026074

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 633 644 N/A INTRINSIC
low complexity region 667 693 N/A INTRINSIC
low complexity region 700 709 N/A INTRINSIC
low complexity region 757 783 N/A INTRINSIC
low complexity region 837 850 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
CNH 916 1214 2.76e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191865
Predicted Effect probably benign
Transcript: ENSMUST00000191964
SMART Domains Protein: ENSMUSP00000141235
Gene: ENSMUSG00000026074

DomainStartEndE-ValueType
low complexity region 4 28 N/A INTRINSIC
SCOP:d1i7qa_ 35 139 7e-3 SMART
low complexity region 195 206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192355
Predicted Effect probably benign
Transcript: ENSMUST00000192509
SMART Domains Protein: ENSMUSP00000141665
Gene: ENSMUSG00000026074

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 633 644 N/A INTRINSIC
low complexity region 667 693 N/A INTRINSIC
low complexity region 700 709 N/A INTRINSIC
low complexity region 757 783 N/A INTRINSIC
low complexity region 837 850 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
CNH 916 1214 2.76e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193682
SMART Domains Protein: ENSMUSP00000141862
Gene: ENSMUSG00000026074

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
low complexity region 590 616 N/A INTRINSIC
low complexity region 623 632 N/A INTRINSIC
low complexity region 680 706 N/A INTRINSIC
low complexity region 785 814 N/A INTRINSIC
low complexity region 824 837 N/A INTRINSIC
low complexity region 852 862 N/A INTRINSIC
CNH 903 1201 2.76e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195259
SMART Domains Protein: ENSMUSP00000142056
Gene: ENSMUSG00000026074

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 610 621 N/A INTRINSIC
low complexity region 644 670 N/A INTRINSIC
low complexity region 677 686 N/A INTRINSIC
low complexity region 731 757 N/A INTRINSIC
low complexity region 811 824 N/A INTRINSIC
low complexity region 839 849 N/A INTRINSIC
CNH 890 1188 2.76e-127 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195356
Predicted Effect probably benign
Transcript: ENSMUST00000195636
SMART Domains Protein: ENSMUSP00000141613
Gene: ENSMUSG00000026074

DomainStartEndE-ValueType
S_TKc 25 289 3.4e-97 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 610 621 N/A INTRINSIC
low complexity region 644 670 N/A INTRINSIC
low complexity region 677 686 N/A INTRINSIC
low complexity region 731 757 N/A INTRINSIC
low complexity region 836 865 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
low complexity region 903 913 N/A INTRINSIC
CNH 954 1252 1.4e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195860
SMART Domains Protein: ENSMUSP00000141400
Gene: ENSMUSG00000026074

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 721 747 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 811 837 N/A INTRINSIC
low complexity region 891 904 N/A INTRINSIC
low complexity region 919 929 N/A INTRINSIC
CNH 970 1268 2.76e-127 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine protein kinase family. This kinase has been shown to specifically activate MAPK8/JNK. The activation of MAPK8 by this kinase is found to be inhibited by the dominant-negative mutants of MAP3K7/TAK1, MAP2K4/MKK4, and MAP2K7/MKK7, which suggests that this kinase may function through the MAP3K7-MAP2K4-MAP2K7 kinase cascade, and mediate the TNF-alpha signaling pathway. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos around day E9.5-10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 A C 1: 34,724,048 D795A unknown Het
Bank1 A T 3: 136,242,940 S159T possibly damaging Het
Catsperd A G 17: 56,660,169 probably null Het
Cblc A G 7: 19,780,964 probably null Het
Cfap54 T C 10: 92,940,155 Y48C probably damaging Het
Chrng A G 1: 87,206,706 I156M probably benign Het
Dennd5a A T 7: 109,933,671 N297K probably damaging Het
Depdc5 A G 5: 32,924,171 E559G probably damaging Het
Dzip1 A C 14: 118,922,445 M117R possibly damaging Het
Ednrb G T 14: 103,821,674 S305R probably benign Het
Egflam A T 15: 7,219,701 W879R probably damaging Het
Ehbp1l1 T A 19: 5,716,487 D332V probably damaging Het
Far1 T C 7: 113,553,737 Y351H possibly damaging Het
Glrp1 GTGCTGCTGCTGCTGCTGCTGCTGCTG GTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 1: 88,503,275 probably benign Het
Hspd1 A T 1: 55,081,097 D315E probably damaging Het
Kap T C 6: 133,850,094 K92E probably benign Het
Kcnv2 T C 19: 27,323,096 Y116H probably benign Het
Krt82 T C 15: 101,548,435 Y170C probably damaging Het
Krtap13 T C 16: 88,751,636 probably benign Het
Man2a1 A G 17: 64,713,601 K791E probably benign Het
Mdc1 T A 17: 35,849,010 V670D probably benign Het
Mre11a A G 9: 14,826,547 E599G probably benign Het
Mrln T C 10: 70,219,626 I44T possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mycbp2 A T 14: 103,144,333 F3724I probably damaging Het
Npsr1 A G 9: 24,310,005 probably benign Het
Oosp3 T A 19: 11,699,532 probably null Het
Pah T A 10: 87,567,465 L131Q probably damaging Het
Pde6h G A 6: 136,963,208 C64Y probably damaging Het
Pdzd7 C G 19: 45,027,674 V1003L probably benign Het
Pilra T A 5: 137,836,080 M14L probably benign Het
Prkdc T C 16: 15,652,552 probably null Het
Rnf168 A G 16: 32,282,374 E124G probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Spata1 A G 3: 146,487,540 L96P possibly damaging Het
Stk11ip A G 1: 75,529,267 probably benign Het
Stx5a T C 19: 8,755,112 probably benign Het
Tek A G 4: 94,820,224 T340A probably benign Het
Tmeff1 T A 4: 48,604,692 probably null Het
Vmn2r85 T A 10: 130,419,166 M550L probably benign Het
Wdr78 A G 4: 103,096,661 S114P probably benign Het
Zfp14 A G 7: 30,039,171 Y130H probably benign Het
Zfp653 A T 9: 22,057,566 D426E probably benign Het
Zfyve28 G A 5: 34,196,662 P834L probably damaging Het
Zkscan16 A G 4: 58,957,364 T549A possibly damaging Het
Other mutations in Map4k4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Map4k4 APN 1 40004816 missense probably damaging 0.99
IGL00417:Map4k4 APN 1 40014532 missense possibly damaging 0.92
IGL00516:Map4k4 APN 1 40014602 missense probably damaging 1.00
IGL01545:Map4k4 APN 1 40014229 splice site probably benign
IGL02092:Map4k4 APN 1 39986783 missense probably benign 0.12
IGL02092:Map4k4 APN 1 40024348 missense probably damaging 1.00
IGL02570:Map4k4 APN 1 39980579 missense probably benign 0.06
IGL02626:Map4k4 APN 1 40014097 splice site probably benign
IGL02993:Map4k4 APN 1 40014188 missense probably damaging 0.98
IGL03178:Map4k4 APN 1 39986693 missense possibly damaging 0.63
tank UTSW 1 40004864 missense possibly damaging 0.93
IGL02835:Map4k4 UTSW 1 40010600 missense probably damaging 0.99
R0496:Map4k4 UTSW 1 40006822 missense probably damaging 0.99
R0498:Map4k4 UTSW 1 39990178 missense probably benign 0.22
R0588:Map4k4 UTSW 1 40004864 missense possibly damaging 0.93
R0674:Map4k4 UTSW 1 40003815 missense probably damaging 1.00
R1205:Map4k4 UTSW 1 40003844 missense probably damaging 1.00
R1349:Map4k4 UTSW 1 40021159 missense probably damaging 1.00
R1615:Map4k4 UTSW 1 40006830 splice site probably benign
R1763:Map4k4 UTSW 1 40000757 splice site probably benign
R1800:Map4k4 UTSW 1 40023460 missense probably damaging 1.00
R1893:Map4k4 UTSW 1 40001557 missense probably benign 0.08
R2411:Map4k4 UTSW 1 40007496 missense probably damaging 0.96
R2851:Map4k4 UTSW 1 40000755 splice site probably benign
R2987:Map4k4 UTSW 1 39986765 missense probably damaging 1.00
R3087:Map4k4 UTSW 1 40021082 critical splice acceptor site probably null
R3688:Map4k4 UTSW 1 39985171 splice site probably null
R4075:Map4k4 UTSW 1 40023462 missense probably damaging 0.96
R4304:Map4k4 UTSW 1 39973972 missense possibly damaging 0.74
R4564:Map4k4 UTSW 1 39988975 missense probably damaging 1.00
R4569:Map4k4 UTSW 1 40000538 missense probably damaging 1.00
R4613:Map4k4 UTSW 1 40017191 missense probably benign 0.05
R4715:Map4k4 UTSW 1 40019564 missense probably damaging 1.00
R4788:Map4k4 UTSW 1 40003916 missense probably benign 0.01
R4926:Map4k4 UTSW 1 40017225 missense probably damaging 1.00
R4943:Map4k4 UTSW 1 40019594 missense probably damaging 0.99
R5033:Map4k4 UTSW 1 40007502 missense probably damaging 0.99
R5177:Map4k4 UTSW 1 39986762 missense probably damaging 1.00
R5297:Map4k4 UTSW 1 39962217 missense probably damaging 1.00
R5844:Map4k4 UTSW 1 39999876 splice site probably benign
R5952:Map4k4 UTSW 1 39999922 unclassified probably benign
R6111:Map4k4 UTSW 1 40011662 missense probably benign 0.00
R6125:Map4k4 UTSW 1 40003965 missense possibly damaging 0.77
R6838:Map4k4 UTSW 1 39976722 missense probably damaging 1.00
R6927:Map4k4 UTSW 1 40011682 missense probably benign 0.00
R7008:Map4k4 UTSW 1 39988971 missense probably benign 0.44
R7164:Map4k4 UTSW 1 39973972 missense possibly damaging 0.74
R7195:Map4k4 UTSW 1 40019669 missense possibly damaging 0.93
R7352:Map4k4 UTSW 1 39962227 missense unknown
R7589:Map4k4 UTSW 1 40021091 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAGAGGCAGTTGCAACAAG -3'
(R):5'- AAAGTCCACTGCCTCCTCATG -3'

Sequencing Primer
(F):5'- GAACAAGCATATCTCCTGTCTCTAC -3'
(R):5'- CTCTCATTCGCATGGTAAAGAC -3'
Posted On2014-12-04