Incidental Mutation 'R0311:Erich5'
ID25228
Institutional Source Beutler Lab
Gene Symbol Erich5
Ensembl Gene ENSMUSG00000044726
Gene Nameglutamate rich 5
SynonymsBC030476
MMRRC Submission 038521-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R0311 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location34453305-34473892 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 34472939 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 363 (*363W)
Ref Sequence ENSEMBL: ENSMUSP00000058182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060894]
Predicted Effect probably null
Transcript: ENSMUST00000060894
AA Change: *363W
SMART Domains Protein: ENSMUSP00000058182
Gene: ENSMUSG00000044726
AA Change: *363W

DomainStartEndE-ValueType
Pfam:DUF4573 95 251 4.6e-60 PFAM
coiled coil region 318 349 N/A INTRINSIC
low complexity region 353 358 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.6%
  • 20x: 91.6%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A C 7: 120,402,904 M1547L probably damaging Het
Abcb4 A G 5: 8,934,243 K658E probably benign Het
Abr A G 11: 76,509,127 S15P possibly damaging Het
Adgrb2 G C 4: 130,017,129 A1168P probably damaging Het
Adgre4 A T 17: 55,802,010 E339V probably benign Het
Asprv1 T C 6: 86,628,840 W223R probably damaging Het
Ccdc89 A G 7: 90,426,693 E37G probably damaging Het
Cd48 C A 1: 171,699,580 Y191* probably null Het
Chd4 T C 6: 125,101,665 I257T probably benign Het
Clca4b T C 3: 144,932,496 M2V probably benign Het
Dnah11 A T 12: 118,127,133 D1025E probably benign Het
Etl4 A G 2: 20,807,129 D1341G probably damaging Het
Fbxw11 A G 11: 32,722,083 T184A probably benign Het
Fktn A G 4: 53,744,620 Q300R probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gdpd3 G A 7: 126,767,189 R66Q possibly damaging Het
Hexb A G 13: 97,183,819 probably benign Het
Kdm4b A G 17: 56,386,200 R346G probably benign Het
Mbtd1 T A 11: 93,921,357 probably null Het
Med23 T A 10: 24,897,358 C653S possibly damaging Het
Nwd2 A T 5: 63,804,998 I642L probably damaging Het
Olfr1444 A G 19: 12,861,869 I31M probably benign Het
Olfr1448 T A 19: 12,920,096 Y71F possibly damaging Het
Olfr912 T C 9: 38,539,297 V134A probably benign Het
Pbld2 T C 10: 63,054,507 probably null Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Plpp2 C T 10: 79,527,580 R77K probably damaging Het
Pym1 G T 10: 128,765,984 R168L possibly damaging Het
Rbm4 T C 19: 4,787,556 Y300C probably damaging Het
Rnf207 A G 4: 152,315,779 C175R probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Speg T C 1: 75,430,937 V3196A probably damaging Het
Syne1 T A 10: 5,348,943 I1048L possibly damaging Het
Th T C 7: 142,896,041 E41G probably damaging Het
Tmx4 T A 2: 134,598,526 *336L probably null Het
Tnfrsf18 T C 4: 156,026,415 V10A possibly damaging Het
Tnxb A T 17: 34,716,984 I2670F probably damaging Het
Tpx2 T C 2: 152,890,492 V562A probably damaging Het
Vmn2r73 A G 7: 85,871,789 S324P probably benign Het
Vps18 T C 2: 119,297,365 Y890H probably benign Het
Ythdc1 G A 5: 86,835,705 D670N probably damaging Het
Other mutations in Erich5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02137:Erich5 APN 15 34470754 missense probably damaging 0.98
IGL02237:Erich5 APN 15 34471336 missense probably benign 0.13
IGL02457:Erich5 APN 15 34470853 missense probably damaging 1.00
R0625:Erich5 UTSW 15 34471369 missense probably damaging 1.00
R2857:Erich5 UTSW 15 34471414 missense probably damaging 1.00
R3745:Erich5 UTSW 15 34470732 missense probably damaging 0.96
R4214:Erich5 UTSW 15 34471411 missense possibly damaging 0.89
R4646:Erich5 UTSW 15 34470966 missense possibly damaging 0.47
R6309:Erich5 UTSW 15 34471456 missense probably benign
R7002:Erich5 UTSW 15 34471362 missense probably damaging 0.98
R7151:Erich5 UTSW 15 34470949 missense probably damaging 0.99
X0024:Erich5 UTSW 15 34470837 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CCTACTGTGTAGACCTAGAGGGCAAA -3'
(R):5'- AACCGTGTCTGGCTTAGCAGTTTTAT -3'

Sequencing Primer
(F):5'- agcccaggaccaccaac -3'
(R):5'- GCATTGTTCTCTTGGTTCCTACAG -3'
Posted On2013-04-16