Incidental Mutation 'R2852:Spata1'
ID252287
Institutional Source Beutler Lab
Gene Symbol Spata1
Ensembl Gene ENSMUSG00000028188
Gene Namespermatogenesis associated 1
SynonymsSP-2, 4921536I21Rik
MMRRC Submission 040445-MU
Accession Numbers

Genbank: NM_027617

Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R2852 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location146457196-146499753 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 146487540 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 96 (L96P)
Ref Sequence ENSEMBL: ENSMUSP00000142800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029839] [ENSMUST00000093951] [ENSMUST00000197980]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029839
AA Change: L96P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029839
Gene: ENSMUSG00000028188
AA Change: L96P

DomainStartEndE-ValueType
low complexity region 89 100 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
Pfam:SPATA1_C 279 428 1.7e-56 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000093951
AA Change: L96P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000091483
Gene: ENSMUSG00000028188
AA Change: L96P

DomainStartEndE-ValueType
low complexity region 89 100 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197684
Predicted Effect possibly damaging
Transcript: ENSMUST00000197980
AA Change: L96P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142800
Gene: ENSMUSG00000028188
AA Change: L96P

DomainStartEndE-ValueType
low complexity region 89 100 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
SCOP:d1eq1a_ 267 365 8e-5 SMART
Meta Mutation Damage Score 0.0775 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 A C 1: 34,724,048 D795A unknown Het
Bank1 A T 3: 136,242,940 S159T possibly damaging Het
Catsperd A G 17: 56,660,169 probably null Het
Cblc A G 7: 19,780,964 probably null Het
Cfap54 T C 10: 92,940,155 Y48C probably damaging Het
Chrng A G 1: 87,206,706 I156M probably benign Het
Dennd5a A T 7: 109,933,671 N297K probably damaging Het
Depdc5 A G 5: 32,924,171 E559G probably damaging Het
Dzip1 A C 14: 118,922,445 M117R possibly damaging Het
Ednrb G T 14: 103,821,674 S305R probably benign Het
Egflam A T 15: 7,219,701 W879R probably damaging Het
Ehbp1l1 T A 19: 5,716,487 D332V probably damaging Het
Far1 T C 7: 113,553,737 Y351H possibly damaging Het
Glrp1 GTGCTGCTGCTGCTGCTGCTGCTGCTG GTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 1: 88,503,275 probably benign Het
Hspd1 A T 1: 55,081,097 D315E probably damaging Het
Kap T C 6: 133,850,094 K92E probably benign Het
Kcnv2 T C 19: 27,323,096 Y116H probably benign Het
Krt82 T C 15: 101,548,435 Y170C probably damaging Het
Krtap13 T C 16: 88,751,636 probably benign Het
Man2a1 A G 17: 64,713,601 K791E probably benign Het
Map4k4 T A 1: 40,000,755 probably benign Het
Mdc1 T A 17: 35,849,010 V670D probably benign Het
Mre11a A G 9: 14,826,547 E599G probably benign Het
Mrln T C 10: 70,219,626 I44T possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mycbp2 A T 14: 103,144,333 F3724I probably damaging Het
Npsr1 A G 9: 24,310,005 probably benign Het
Oosp3 T A 19: 11,699,532 probably null Het
Pah T A 10: 87,567,465 L131Q probably damaging Het
Pde6h G A 6: 136,963,208 C64Y probably damaging Het
Pdzd7 C G 19: 45,027,674 V1003L probably benign Het
Pilra T A 5: 137,836,080 M14L probably benign Het
Prkdc T C 16: 15,652,552 probably null Het
Rnf168 A G 16: 32,282,374 E124G probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Stk11ip A G 1: 75,529,267 probably benign Het
Stx5a T C 19: 8,755,112 probably benign Het
Tek A G 4: 94,820,224 T340A probably benign Het
Tmeff1 T A 4: 48,604,692 probably null Het
Vmn2r85 T A 10: 130,419,166 M550L probably benign Het
Wdr78 A G 4: 103,096,661 S114P probably benign Het
Zfp14 A G 7: 30,039,171 Y130H probably benign Het
Zfp653 A T 9: 22,057,566 D426E probably benign Het
Zfyve28 G A 5: 34,196,662 P834L probably damaging Het
Zkscan16 A G 4: 58,957,364 T549A possibly damaging Het
Other mutations in Spata1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Spata1 APN 3 146476242 missense possibly damaging 0.94
IGL01306:Spata1 APN 3 146487399 nonsense probably null
IGL01537:Spata1 APN 3 146489803 splice site probably benign
IGL02363:Spata1 APN 3 146487364 missense possibly damaging 0.96
IGL02873:Spata1 APN 3 146487367 missense possibly damaging 0.86
IGL02898:Spata1 APN 3 146475339 missense possibly damaging 0.71
IGL03071:Spata1 APN 3 146475334 missense possibly damaging 0.93
IGL03204:Spata1 APN 3 146488679 missense probably benign 0.18
ANU23:Spata1 UTSW 3 146487399 nonsense probably null
H8930:Spata1 UTSW 3 146487271 nonsense probably null
R0414:Spata1 UTSW 3 146476188 splice site probably null
R1109:Spata1 UTSW 3 146475298 missense possibly damaging 0.51
R1742:Spata1 UTSW 3 146469623 critical splice donor site probably null
R1816:Spata1 UTSW 3 146481207 missense probably damaging 0.98
R2006:Spata1 UTSW 3 146493683 missense probably benign 0.18
R2851:Spata1 UTSW 3 146487540 missense possibly damaging 0.96
R3416:Spata1 UTSW 3 146487508 splice site probably benign
R3911:Spata1 UTSW 3 146475324 missense probably damaging 0.99
R4856:Spata1 UTSW 3 146469774 missense probably damaging 0.99
R4859:Spata1 UTSW 3 146469774 missense probably damaging 0.99
R4886:Spata1 UTSW 3 146469774 missense probably damaging 0.99
R6902:Spata1 UTSW 3 146475323 missense possibly damaging 0.77
R7459:Spata1 UTSW 3 146476222 missense possibly damaging 0.86
R7532:Spata1 UTSW 3 146468191 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TGTTGATGCTGAATAAACATTTCCT -3'
(R):5'- ACACCAATTCCCATGCAAATGAT -3'

Sequencing Primer
(F):5'- TCCTAAGTGATCTATTACAGGAAGC -3'
(R):5'- TCAGTTAAGTTTGGTTCAGTGAATAG -3'
Posted On2014-12-04