Incidental Mutation 'R2570:Stradb'
ID252302
Institutional Source Beutler Lab
Gene Symbol Stradb
Ensembl Gene ENSMUSG00000026027
Gene NameSTE20-related kinase adaptor beta
SynonymsAls2cr2, D1Ucla2, PRO1038
MMRRC Submission 040428-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2570 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location58973522-58995715 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 58988584 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 91 (T91I)
Ref Sequence ENSEMBL: ENSMUSP00000138036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027185] [ENSMUST00000114296] [ENSMUST00000123301] [ENSMUST00000153990]
Predicted Effect probably damaging
Transcript: ENSMUST00000027185
AA Change: T91I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027185
Gene: ENSMUSG00000026027
AA Change: T91I

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 58 290 3.2e-26 PFAM
Pfam:Pkinase 58 369 7.9e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114296
AA Change: T91I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109935
Gene: ENSMUSG00000026027
AA Change: T91I

DomainStartEndE-ValueType
Pfam:Pkinase 58 185 1.1e-16 PFAM
Pfam:Pkinase_Tyr 58 188 1.3e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123301
AA Change: T91I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138036
Gene: ENSMUSG00000026027
AA Change: T91I

DomainStartEndE-ValueType
Pfam:Pkinase 58 184 2.7e-17 PFAM
Pfam:Pkinase_Tyr 58 185 1.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147637
Predicted Effect probably benign
Transcript: ENSMUST00000152318
Predicted Effect probably benign
Transcript: ENSMUST00000153990
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the serine/threonine protein kinase STE20 subfamily. One of the active site residues in the protein kinase domain of this protein is altered, and it is thus a pseudokinase. This protein is a component of a complex involved in the activation of serine/threonine kinase 11, a master kinase that regulates cell polarity and energy-generating metabolism. This complex regulates the relocation of this kinase from the nucleus to the cytoplasm, and it is essential for G1 cell cycle arrest mediated by this kinase. The protein encoded by this gene can also interact with the X chromosome-linked inhibitor of apoptosis protein, and this interaction enhances the anti-apoptotic activity of this protein via the JNK1 signal transduction pathway. Two pseudogenes, located on chromosomes 1 and 7, have been found for this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T A 5: 121,630,204 N763I probably damaging Het
Actr8 T C 14: 29,987,282 V281A probably damaging Het
Adam1b A T 5: 121,501,748 N411K probably damaging Het
Adamdec1 T A 14: 68,579,208 Q77L probably damaging Het
Adgre4 T A 17: 55,778,878 F59Y possibly damaging Het
Akr1c18 T C 13: 4,142,164 N178S probably benign Het
Aldh1a7 T A 19: 20,699,956 T434S probably benign Het
B020004J07Rik T C 4: 101,837,246 T147A probably benign Het
BC067074 C T 13: 113,318,587 T389I probably benign Het
Bcl10 T A 3: 145,933,030 N142K probably benign Het
C1qc T C 4: 136,890,091 I231M probably benign Het
Cacna1b A T 2: 24,606,637 L2307* probably null Het
Cadm2 G A 16: 66,815,383 S106L probably damaging Het
Cdc42bpa G A 1: 180,150,177 R1518Q possibly damaging Het
Cdk12 T G 11: 98,203,792 M142R possibly damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp2c50 C G 19: 40,090,320 H90D probably benign Het
Dach1 A G 14: 97,901,411 M480T probably benign Het
Dennd1a A T 2: 37,844,783 F57L probably damaging Het
Dhcr24 T C 4: 106,585,832 F355L probably benign Het
Drc1 A G 5: 30,355,265 R339G probably damaging Het
Efna5 A T 17: 62,881,028 Y35N probably benign Het
Ehmt1 A G 2: 24,815,741 V811A probably damaging Het
Fam135a A T 1: 24,021,964 V1114E probably damaging Het
Frmd8 C A 19: 5,874,712 R28L probably damaging Het
Gm11639 T A 11: 104,733,664 S840R probably damaging Het
Gm9936 A G 5: 114,857,544 probably benign Het
Hgsnat C T 8: 25,945,252 W618* probably null Het
Itgal T C 7: 127,314,096 F622L probably damaging Het
Kalrn C T 16: 34,310,495 E451K probably damaging Het
Kat2a A T 11: 100,710,822 F256I probably damaging Het
Lama4 A T 10: 39,075,358 D1033V possibly damaging Het
Lama4 T A 10: 39,106,047 D1757E probably damaging Het
Laptm5 T C 4: 130,932,047 Y212H probably damaging Het
Lsm10 T C 4: 126,097,923 L24P probably damaging Het
Mtfp1 T C 11: 4,094,504 E27G probably damaging Het
Ncaph2 C A 15: 89,370,475 D399E probably benign Het
Ncor2 T C 5: 125,028,800 probably null Het
Nek9 A C 12: 85,332,546 Y195* probably null Het
Npas1 T C 7: 16,474,703 D83G probably damaging Het
Nrsn2 A T 2: 152,369,821 F97I possibly damaging Het
Oas1c T C 5: 120,805,438 N10S probably benign Het
Olfr545 T C 7: 102,493,899 N292S probably damaging Het
Olfr58 T A 9: 19,784,009 L292Q probably damaging Het
Olfr693 A G 7: 106,677,667 I273T probably benign Het
Pcdha4 A T 18: 36,953,612 T283S probably benign Het
Pdk1 A C 2: 71,873,560 D64A possibly damaging Het
Ptpdc1 C T 13: 48,586,063 A631T probably benign Het
Rasal2 G T 1: 157,161,300 A660E possibly damaging Het
Sgpp2 T A 1: 78,360,150 V55E possibly damaging Het
Shank2 A T 7: 144,068,770 I214F probably damaging Het
Slfn14 T C 11: 83,283,607 N186S probably benign Het
Soga3 A T 10: 29,146,765 Q36L possibly damaging Het
Sptbn5 A T 2: 120,048,640 noncoding transcript Het
Sulf2 T C 2: 166,085,801 I359V probably benign Het
Tbl3 A T 17: 24,703,316 M405K possibly damaging Het
Tecta G T 9: 42,332,552 D2001E probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Tgfbi T A 13: 56,638,708 probably null Het
Tmem132a A T 19: 10,859,742 L612Q probably null Het
Tnf T C 17: 35,200,500 N102S probably damaging Het
Trib3 A T 2: 152,343,236 V31D probably benign Het
Ube2q2 T A 9: 55,191,856 F248L probably benign Het
Usf3 T C 16: 44,216,381 V408A probably benign Het
Vmn1r159 T C 7: 22,842,882 M242V probably benign Het
Vmn2r105 A T 17: 20,227,323 L413H probably damaging Het
Zbtb2 T G 10: 4,368,673 N451T probably damaging Het
Zfp593 C A 4: 134,245,558 probably benign Het
Other mutations in Stradb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00784:Stradb APN 1 58988529 missense probably damaging 0.98
IGL00843:Stradb APN 1 58994409 missense probably benign
IGL01288:Stradb APN 1 58992301 missense possibly damaging 0.61
IGL02045:Stradb APN 1 58989778 missense probably damaging 1.00
IGL02818:Stradb APN 1 58979962 missense probably damaging 0.99
P0047:Stradb UTSW 1 58989798 missense probably null 0.86
R0739:Stradb UTSW 1 58977015 unclassified probably benign
R0970:Stradb UTSW 1 58977060 missense possibly damaging 0.92
R1809:Stradb UTSW 1 58994390 missense possibly damaging 0.54
R1930:Stradb UTSW 1 58991105 missense probably benign 0.07
R1931:Stradb UTSW 1 58991105 missense probably benign 0.07
R1932:Stradb UTSW 1 58991105 missense probably benign 0.07
R2919:Stradb UTSW 1 58992669 missense probably benign 0.44
R3104:Stradb UTSW 1 58992291 missense possibly damaging 0.86
R3105:Stradb UTSW 1 58992291 missense possibly damaging 0.86
R3106:Stradb UTSW 1 58992291 missense possibly damaging 0.86
R3772:Stradb UTSW 1 58985385 missense probably benign 0.04
R4120:Stradb UTSW 1 58980009 missense possibly damaging 0.92
R4417:Stradb UTSW 1 58994372 missense probably benign
R4569:Stradb UTSW 1 58979958 nonsense probably null
R4601:Stradb UTSW 1 58993572 missense probably damaging 0.98
R4758:Stradb UTSW 1 58988571 missense probably benign 0.02
R4786:Stradb UTSW 1 58991208 intron probably benign
R4944:Stradb UTSW 1 58980440 missense probably benign 0.27
R5113:Stradb UTSW 1 58991174 intron probably benign
R5568:Stradb UTSW 1 58992742 missense possibly damaging 0.72
R5765:Stradb UTSW 1 58992744 missense probably benign 0.31
R5970:Stradb UTSW 1 58980016 critical splice donor site probably null
R6234:Stradb UTSW 1 58988548 missense probably damaging 1.00
R7411:Stradb UTSW 1 58988518 missense possibly damaging 0.95
R7511:Stradb UTSW 1 58992949 missense probably damaging 0.97
R7569:Stradb UTSW 1 58991151 missense unknown
R7575:Stradb UTSW 1 58988580 missense probably benign 0.00
R7646:Stradb UTSW 1 58994408 missense probably benign 0.14
R7658:Stradb UTSW 1 58992726 missense probably damaging 0.96
R8306:Stradb UTSW 1 58991197 missense unknown
R8812:Stradb UTSW 1 58994319 missense probably benign 0.16
Z1176:Stradb UTSW 1 58992999 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTGGTGCTGAGGATACC -3'
(R):5'- ACGTGTTCTTCCCAATCTGG -3'

Sequencing Primer
(F):5'- TGAGGATACCTGAGCCTTTTC -3'
(R):5'- CCCAATCTGGTAACTGCATGACTTAG -3'
Posted On2014-12-04